Cell lines, medium and cell culture
Human bladder cancer cell lines T24 and J82 were purchased from the American Type
Culture Collection (ATCC, Rockville, MD, USA) and were cultured in 10Â % fetal bovine
serum (Invitrogen) Dulbecco’s Modified Eagle’s Medium (DMEM) (Invitrogen, Carlsbad,
CA, USA)) supplemented with penicillin (100 units/ml) and streptomycin (100Â ?g/ml).
Cells were incubated at 37 °C with 5 % CO
2
.
Construction of STAT3-KD Cell Line
To construct a stable STAT3-KNOCKDOWN cell line, we transfected T24 cells with lentivirus-based
shRNA vector (purchased from GenePharma, Shanghai, China). The shRNA oligonucleotides
sequences targeting STAT3 and acting as normal control are as follows: GCGTCCAGTTCACTACTAAAG;
TTCTCCGAACGTGTCACGT. Transfections were performed with polybrene (GenePharma) according
to manufacturer’s instruction. Stable clones were selected in 1000 ?g/ml neomycin
(Invitrogen) for 2Â months.
Cell viability assay
Cell viability assays were performed with a Cell Counting Kit-8 (Dojindo, Kumamoto,
Japan). Cells were seeded in 96-well plates in triplicate (5?×?10
3
per well) for 24Â h. Then the medium was removed and replaced by fresh culture medium
containing metformin (Sigma-Aldrich, St. Louis, MO, USA) in various concentrations
(0, 10, 20, 40 or 60Â mM) for 24 or 48Â h. The number of viable cells per well was measured
by the absorbance (450Â nm) of reduced 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,
4-isulfophenyl)-2H-tetrazolium (monosodium salt) using the Microplate Autoreader (Bio-Tek
Instruments Inc., Winooski, VT, USA). Independent experiments were repeated for three
times.
Analysis of cell cycle and apoptosis
Cell apoptosis detection kit (propidium iodide (PI), RNase staining buffer and FITC-labeled
Annexin V) were purchased from BD Pharmingen (San Diego, CA, USA). Cells were seeded
2.5?×?10
5
per well in 6-well plates for 24Â h. Then the medium was replaced by culture medium
containing metformin 0, 20 or 40Â mM for 24 or 48Â h. The cells were harvested for analysis
of cell cycle and apoptosis, respectively. The cell cycle was analyzed using PI staining,
according to the manufacturer’s instructions. Briefly the cells were fixed in 70 %
ethanol, stained with PI, and the amount of PI-labeled DNA in a cell was measured
by a flow cytometer (Accuri C6, Becton Dickinson, San Jose, CA, USA). The acquired
data were analyzed by FlowJo software (Ashland, OR, USA). To determine the apoptotic
cells, the cells were stained with Annexin V-FITC and PI immediately after harvesting,
and analyzed by flow cytometry, as described by the manufacturer’s instructions.
Wound healing assay
T24 cells were seeded 5?×?10
5
per well in 6-well plates and cultured until they reached complete confluence. Cells
were scratched with a pipette tip and washed with PBS buffer. Then cells were cultured
in 1Â % FBS DMEM containing metformin (0, 10 or 20Â mM). Photographs were taken in pre-marked
spots at 0, 12 and 24Â h of culture for comparison. The number of cells migrated into
the wound areas was counted.
Transwell assay
T24 cells were treated with metformin (0, 10 or20 mM) for 24Â h. Then cells were seeded
3?×?10
4
cells per well in 150Â ?l 1Â % FBS DMEM supplemented with 0, 10 or 20Â mM metformin into
the upper chamber of the transwell in 24-well plates (growth surface area of insert:
0.33Â cm
2
; membrane pore size, 8Â ?m; Corning Incorporated; Corning, NY, USA) with or without
Matrigel (BD Pharmingen), and 500Â ?l 10Â % FBS DMEM was added into the lower chamber.
After 24Â h, the bottom of the inserts were fixed in methanol for 10Â min and stained
with 0.1Â % crystal violet staining solution. The cells migrating or invading into
the bottom-lower surfaces of inserts were measured by using an inverted phase contrast
microscope.
Western blot analysis
The cells and tissues were collected and lysed in Radio-Immunoprecipitation Assay
(RIPA) buffer (Thermo Fisher, Rockford, IL, USA) containing 1Â % phenylmethylsulfonyl
fluoride (PMSF). Protein concentration was quantified with the BCA Protein Kit (Beyotime,
China). Lysates (30Â ?g protein) were separated by 10Â % SDS-PAGE gels electrophoresis
and transferred to a PVDF membrane (Bio-Rad, Hercules, CA, USA). The membranes were
blocked in TBS/Tween20 (TBST) buffer containing 5Â % non-fat milk powder for 2Â h at
room temperature, and then probed with primary antibodies overnight at 4 °C. Rat monoclonal
antibodies (mAbs) to pstat3 (Y705), stat3, cyclin D1, Bcl-XL, Bcl2 and ?-actin were
purchased from Cell Signaling (Beverly, MA, USA), horseradish peroxidase (HRP)-conjugated
anti-rabbit IgG antibody was purchased from Santa Cruz Biotechnology (Santa Cruz,
CA, USA). After incubated with secondary antibodies for 1Â h at room temperature, protein
signal was detected with the ECL chemiluminescent detection system (Bio-Rad), and
protein levels were normalized to ?-actin.
Immunofluorescent microscopic analysis
For cytochemical analysis of phosphorylated STAT3 (pstat3), cells cultured in 96-well
plates were fixed and permeablized in methanol for 30Â min followed by blockage in
5Â % bovine serum albumin (BSA) for a another 30Â min and then incubated with primary
antibody overnight at 4 °C. The cells were washed 3 times with Tris-Buffer Solution
Tween (TBST) and then incubated for 1Â h with FITC-conjugated anti-rabbit IgG secondary
antibody (BD Pharmingen) at room temperature. Nuclei were stained with Hoechst 33342
(10Â ?g/ml; Sigma-Aldrich) for 3Â min. Samples were examined and microphotographed under
a fluorescent microscope (Nikon Instruments Inc. Melville, USA).
Real-time PCR analysis
Total RNA was extracted from human bladder cancer cells using Trizol (Invitrogen).
The cDNA was synthesized from 0.5Â ?g of RNA with a Prime Script Kit (TAKARA, Toyobo,
Osaka, Japan). Gene transcription levels were quantified by real-time quantitative
PCR with SYBR Green PCR real-time PCR Master Mix (TAKARA). ?-actin was used as an
endogenous control. All the samples were detected in triplicate for each experiment.
All results shown were representatives of three independent experiments, and mRNA
levels were expressed as 2
-??CT
. The PCR were performed with a two-step qRT-PCR at 95 °C for 10 min, then 40 cycles
of 95 °C for 15 s and 60 °C for 1 min, followed by 95 °C for 15 s. The specific primers
used were listed as follows:
?-actin forward: CATGTACGTTGCTATCCAGGC, reverse: CTCCTTAATGTCACGCACGAT,
Bcl2 forward: GGTGGGGTCATGTGTGTGG, reverse: CGGTTCAGGTACTCAGTCATCC.
Bcl-XL forward: GAGCTGGTGGTTGACTTTCTC, reverse: TCCATCTCCGATTCAGTCCCT.
cyclin D1 forward: GCTGCGAAGTGGAAACCATC, reverse: CCTCCTTCTGCACACATTTGAA.
Establishment of orthotopic rat bladder cancer model
Twenty-four female SD rats weighting around 280Â g were obtained from the Experimental
Animal Center of Renji Hospital, School of Medicine, Shanghai Jiaotong University
(Shanghai, China) and housed in the center. Animal protocols in the study were approved
by the Institutional Animal Care and Use Committee of Renji Hospital, School of Medicine,
Shanghai Jiaotong University. They were maintained in an air-conditioned room lighted
12Â h every day , given standard laboratory rat chow and could freely access to tap
water. All rats were acclimatized for 7Â days before the experiments started. The rats
were divided into three groups (Additional file 1: Figure S1): a control group (?=?8); an N-methyl-N-nitrosourea (MNU)-treated group (MNU group) (?=?8); and a group of rats cotreated with MNU and metformin (Met group) (?=?8). Briefly, the rats were anesthetized i.p. with Nembutal (50Â mg/kg). Two mg of
MNU (Sigma-Aldrich) that was dissolved in sodium citrate buffer (10Â mg/ml) was administered
to the rats of the MNU group and the Met group via rat epidural catheter intravesically
within 30Â min of preparation of MNU solution every other week (weeks 0, 2, 4 and 6)
for a total 4 doses. The rats remained anesthetized for approximately 2Â h after catheterization.
Rats of the Met group were administered with metformin (2Â g/L) in the drinking water.
All the rats were monitored for 14-weeks. Body weight (BW) was measured every two
weeks and drinking water was replaced twice a week during the experimental period.
Fig. 1. Metformin inhibited the proliferation, cell cycling and viability of bladder cancer
cells. aInhibition of cell proliferation: J82 and T24 cells were seeded 5?×?10
3
per well in 96-well plates for 24Â h. Then cells were treated with metformin (0, 10,
20, 40, or 60Â mM) for 24 or 48Â h. Cell numbers and viability was evaluated by CCK8.
bCell cycle arrested at G 0 /G 1 phases: J82 and T24 cells were treated with 20Â mM metformin for 24 or 48Â h and cell cycle
were analyzed by flow cytometry. cPromotion of apoptotic cell death: J82 and T24 cells were treated with 20 and 40Â mM metformin for 24 or 48Â h, stained
with PI and FITC-labelled Annexin V and determined by flow cytometry for the frequency
of apoptotic cells. Top panel: representative histograms of cell cycling; bottom panel:
summary of apoptotic cells (%) from three reproducible experiments. **, P??0.01 when compared to control group (0Â mM) in all the experiments
At the end of the experiment, all the rats were sacrificed by intraperitoneal administration
of an overdose of Nembutal. The lungs, stomach, liver, kidneys, uteruses and intestines
were harvested and evaluated for metastatic lesions. Before removal, bladders were
fixed by intravesically injecting 1Â ml buffered formaldehyde solution. After overnight
pre-fixation, each bladder was cut open, and its mucosal surface was macroscopically
evaluated for urothelium lesions. Then the bladder tissues were processed for paraffin-embedding
and sectioning. The paraffin-embedded tissues were sectioned in a 2Â ?m thickness,
mounted in slides and stained with haematoxylin eosin (HE). The slides were randomized
and carefully examined histologically by two pathologists indepently. Histologic lesions
were classified and staged according to the World Health Organization/International
Society of Urological Pathology Consensus Classification of Urothelial (Transitional
Cell) Neoplasms of the Urinary Bladder.
Statistical analysis
All data were presented as means?±?S.D. All statistical analysis was performed with
GraphPad Prism version 5.00 software from GraphPad Software (San Diego, CA, USA).
For in vitro studies, comparison between control group and metformin-treated group was performed
by using Student’s t-test. For in vivo studies, difference between tumor areas was assessed by Student’s t-test, and histopathological
examination was evaluated by Chi-square test. The P-value of??0.05 was considered
statistically significant, p??0.01 was considered statistically highly significant.
