Tech Science Daily News

Tech Science Health Daily News

Alpha-l-Fucosidase Isoenzyme iso2 from Paenibacillus thiaminolyticus


Bacterial strains and cultivation conditions

A strain of P. thiaminolyticus (CCM 3599, Czech Collection of Microorganisms in Brno) was cultivated in Luria-Bertani
(LB) medium, 16 h, 30 °C, 250 rpm. E. coli DH5? (GibcoBRL) and E. coli BL21 (DE3) (Novagen) were cultivated in LB medium containing ampicillin (final concentration
was 0.1 mg/mL, AppliChem GmbH), 16 h, 37 °C, 250 rpm. After cultivation, bacterial
cultures were harvested by centrifugation (4,000 x g, 20 min, 4 °C).

?-L-Fucosidase isoenzymes Identification

The cell lysate from P. thiaminolyticus was prepared using a lysozyme (final concentration of 5 mg/mL, 30 min incubation
at a laboratory temperature, Fluka), and a sodium deoxycholate (final concentration
of 0.1 %, 30 min incubation at 4 °C, Fluka). Disintegration process was followed by
addition of DNaseI (20 U to 1 mL, 15 min incubation at laboratory temperature, Sigma-Aldrich)
and sonication (20 W, 6?×?30 s, on ice) with Sonicator® 3000 ultrasonic liquid processor
(Misonix Inc.). The insoluble cell debris was removed by centrifugation (20,000?×?g,
20 min, 4 °C). The clear supernatant was precipitated using ammonium sulphate. The
precipitate between 40 and 75 % of saturation was collected, resuspended in 25 mM
EPPS buffer, pH 8.0 containing 750 mM ammonium sulphate and applied onto the column
HiTrap Butyl FF (1 mL) (GE Healthcare). The decreasing linear gradient of ammonium
sulphate (1 M – 0 M) in 25 mM EPPS buffer, pH 8.0 was used for the elution. The activity
of ?-L-fucosidase was measured in the collected fractions using chromogenic substrate pNP?-L-Fuc and native electrophoresis was used for confirmation of the two isoenzymes presence.
The electrophoresis was performed under native conditions (6.8 % running gel, 100 V,
4 °C) and the ?-L-fucosidase activity was detected directly in the gel using chromogenic substrate
pNP?-L-Fuc (6.6 mM in 25 mM EPPS buffer, pH 8.0).

Identification of the gene for ?-L-fucosidase iso2

The gene of ?-L-fucosidase iso2 was found in the same procedure as the gene of ?-L-fucosidase iso1 from P. thiaminolyticus18] using chromogenic substrate X-Fuc (Biosynth AG®) for screening genomic library in
E. coli DH5?. Positive colony was found and its plasmid DNA was sequenced by the “primer
walking” method (Geneart). The open reading frames were identified using the WU-BLAST2
program.

Construction of an expression plasmid pET16b-?LF2

The gene of ?-L-fucosidase iso2 was inserted into the plasmid pET16b (Novagen) containing His-Tag.
Plasmid was cleaved by restriction endonucleases NdeI and XhoI (New England BioLabs), dephosphorylated by Calf Intestinal Alkaline Phosphatase
(Invitrogen) and purified by Wizard® DNA Clean-Up System (Promega Corporation). The
DNA fragment containing the ?-L-fucosidase gene was obtained by polymerase chain reaction (PCR) using primers, in
which the NdeI restriction site was inserted at the 5’- end of the gene (GACGACGA

    CATATG

CGCTACAGACAGGTTCACC) and XhoI restriction site at the 3’- end (CCTTCCTC

    CTCGAG

CTACTCATTATACTCTACGACG). The plasmid DNA from positive colony was used as a template.
PCR product was purified by a commercial kit Wizard® SV Gel and PCR Clean-Up System
(Promega Corporation). The purified DNA fragment was treated with NdeI and XhoI endonucleases, and ligated using T4-DNA ligase (New England BioLabs) to the linearized
and dephosphorylated expression plasmid pET16b. The competent cells of E. coli DH5? were transformed 21] by the ligation mixture and cultivated on LB plates with ampicillin. Plasmid DNA
of the arised colonies was screened by restriction endonucleases, and the gene of
?-L-fucosidase iso2 in the positive colony was confirmed by sequencing. The name pET16b-?LF2
is used for this construct in the text.

Expression and purification of recombinant ?-L-fucosidase iso2

The cells of E.coli BL21 (DE3) were used for production of recombinant ?-L-fucosidase iso2. These cells transformed by pET16b-?LF2 were grown at 37 °C in LB
medium containing ampicillin (final concentration 0.1 mg/mL). Isopropyl ?-D-thiogalactopyranoside (IPTG) as an inducer of expression was added after 5 hours of
cultivation (OD600nm 0.6) to the final concentration 300 ?mol/L. The ?-L-fucosidase iso2 was expressed for another 4 hours. The cells were harvested by centrifugation
(6,000 x g, 15 min, 4 °C).

The bacterial pellet was resuspended in binding buffer (50 mM phosphate buffer, pH 7.0,
150 mM KCl) and disintegrated in the same way as the cells of P. thiaminolyticus. The insoluble cell debris was removed by centrifugation (20,000?×?g, 20 min, 4 °C)
and the clear supernatant was stored at –20 °C or applied directly to Ni-NTA Agarose
(Novagen) preequilibrated with the binding buffer with 10 mM imidazole. The standard
purification protocol for Ni-NTA Agarose was used for purification of ?-L-fucosidase iso2. The concentration of imidazole in binding buffer was 40 mmol/L for
washing and 250 mmol/L for elution. After elution all fractions were assayed for ?-L-fucosidase activity. Fractions displaying ?-L-fucosidase activity were put together and desalted using gel chromatography (PD10,
GE Healthcare).

SDS-PAGE was used for molecular weight and purity determination. It was performed
in 10 % polyacrylamide gel in a Mini-Protean III dual-slab cell electrophoresis unit
(Bio-Rad) under reducing conditions 22] and the proteins were visualized by Coomassie Brilliant Blue R250.

?-L-Fucosidase activity assay

The hydrolytic activity of ?-L-fucosidase was determined by measuring the release of p-nitrophenol from pNP?-L-Fuc, quantified by its absorbance at 405 nm. Enzyme reactions were performed by diluting
the enzyme in 50 mM phosphate buffer, pH 7.0 at 37 °C and the reaction was started
by the addition of pNP?-L-Fuc (10 mmol/L in reaction mixture). The reaction was stopped in 10 minutes by adding
an equal volume of 10 % Na2CO3. One U is defined as the amount of the enzyme that releases 1 ?mol of p-nitrophenol per minute.

?-L-Fucosidase characterisation

Purified recombinant ?-L-fucosidase was used for enzyme characterization. To measure Michaelis–Menten constant
and maximal velocity, the chromogenic substrate pNP?-L-Fuc in concentration range 0.01-35 mmol/L in reaction mixture was used. The values
of Km, Ks a Vlim were calculated using iterative method for statistical evaluation of deviations with
the use of tools solver (Microsoft Excel). Following equation was used to calculate
the constants, where v0 represents initial velocity, [S] substrate concentration, Km is used for Michaelis constant, Vlim for maximum velocity and KS is used for inhibition constant (Copeland 2000) 23]: , taking into account the substrate inhibition.

Temperature optimum was determined by measuring ?-L-fucosidase activity in different temperatures ranging from 20 to 70 °C. Temperature
stability of the enzyme was determined by incubation of the enzyme at different temperatures
(-20, 4, 30, 40, 50 and 60 °C) for specific time intervals and for subsequent standard
activity assay. pH optimum of ?-L-fucosidase was found by measuring the enzyme activity in a set of Britton–Robinson
buffers (pH range from 2–11).

Transglycosylation reactions

The ability of recombinant ?-L-fucosidase iso2 to catalyse transfer of ?-L-fucosyl moiety to different types of acceptor molecules was studied. All transglycosylation
reactions were carried out in 50 mM phosphate buffer (pH 6.5) at 40 °C (25 mM EPPS
buffer, pH 8 at 50 °C for the experiments with p-nitrophenyl glycopyranosides as acceptors). pNP?-L-Fuc served as a donor of L-fucose. It was solubilized in concentrated DMF, due to its low solubility in buffer.
The final concentration of pNP?-L-Fuc in transfucosylation mixtures was 50 mmol/L (with the exception of the reaction
mixture where pNP?-L-Fuc served as donor as well as acceptor and its final concentration was 83 mmol/L)
and final concentration of DMF was 10 % (except of the mixture with p-nitrophenyl glycopyranosides as acceptors, where DMF was not used at all). The final
concentrations of acceptors in a reaction mixture were: 33 mmol/L for p-nitrophenyl glycopyranosides (p-nitrophenyl ?-D-galactopyranoside (pNP?-D-Gal), p-nitrophenyl ?-D-glucopyranoside (pNP?-D-Glc) and p-nitrophenyl ?-D-mannopyranoside (pNP?-D-Man), purchased from Sigma-Aldrich), 50 mmol/L for saccharides (D-glucose, D-galactose, D-fructose, D-mannose, D-maltose, D-glucosamine and N-acetyl-D-glucosamine, purchased from Sigma-Aldrich), 50 mmol/L for amino acid derivatives
(N-(tert-butoxycarbonyl)-L-serine methyl ester (Boc-L-Ser-OMe) and N-(tert-butoxycarbonyl)-L-threonine methyl ester (Boc-L-Thr-OMe), purchased from Sigma-Aldrich), and 10 % for alcohols (methanol, ethanol,
1-propanol, 2-propanol, butanol, pentanol, octanol, purchased from Fluka). The amount
of the enzyme in the reaction mixtures corresponded to 0.032 U/mL for reactions with
p-nitrophenyl glycopyranosides, alcohols and amino acid derivatives and to 3.2 U/mL
for reactions with saccharidic acceptors. Reaction time was 24 hours in all cases.
After transglycosylation reactions the reaction mixtures were analyzed by TLC. Transglycosylation
products of N-acetyl-D-glucosamine, methanol and ethanol were confirmed by mass spectrometry analysis in
mode ESI+ (LTQ Orbitrap Velos, Thermo Scientific) with direct inlet in Central Laboratories
of UCT, Prague. After removing of the enzyme by filtration (VectaSpin Centrifuge Tube
Filter (12 kDa)), whole reaction mixtures were used for the analysis.

Thin-layer chromatography

The transglycosylation reactions were analyzed on Silica gel TLC plates (Fluka) developed
by a solvent system ButOH:EtOH:water (4:3:2, v/v/v) for p-nitrophenylglycopyranosidic
acceptors, ethyl acetate: acetic acid: water (6:6:1, v/v/v) for saccharidic acceptors
and ethyl acetate: acetic acid: water (7:2:2, v/v/v) for alcohols and amino acids
used as acceptors. Saccharides were detected by 0.1 M 2-methylresorcinol (Alfa Aesar
GmbH Co KG, Germany) dissolved in 5 % (v/v) solution of sulphuric acid in ethanol
(after heating of TLC plate).