A microbial platform for renewable propane synthesis based on a fermentative butanol pathway

All chemicals, solvents and standards were purchased from Sigma-Aldrich (St. Louis,
MO, USA) and Fisher Scientific (Waltham, MA, USA) and were of analytical grade. Media
components were obtained from Formedium (Norfolk, UK). Gene sequencing and oligonucleotide
synthesis were performed by Eurofins MWG (Ebersberg, Germany). D-Glucose (GOPOD Format)
assay kit was from Megazyme (Wicklow, Ireland).

Strains and plasmids

BL21 (DE3) (fhuA2 [lon] ompT gal (? DE3) [dcm] ?hsdS) cells from Novagen (Madison, WI, USA) were used for protein expression. The ahr (GenBank ID: ACT44688.1) and yqhD (GenBank ID: AAA97166.1) single and double knockout strains were generated in a previous
study 10]. The structure of all plasmids is graphically depicted in Figure 7, and their preparation is described below.

Figure 7. The plasmid design used to construct engineered propane producing pathways inE.coli. The structure of all plasmids used in this study for E. coli pathway engineering is shown. The preparation and design of these plasmids are described
in the ‘Materials and method’ section.

pET-TPC7

The pET-TPC7 plasmid was constructed in a pETDuetT-1 vector (ColE1 replicon, Ampicillin^R, from Novagen) by replacing TE4 acyl-ACP thioesterase with a synthesized gene encoding
YciA (Haemophilus influenza, GenBank ID: AAC22485.1) in pET-TPC4 backbone plasmid described in the previous study
using restriction sites HindIII and NcoI 10]. The final plasmid contained synthesized genes encoding Sfp (maturation factor phosphopantetheinyl
transferase from Bacillus subtilis, GenBank ID: X65610.1) and CAR (carboxylic acid reductase from M. marinum, GenBank ID: ACC40567.1) upstream to yciA.

pACYC-NHCT

The pACYC-NHCT plasmid was constructed in a pACYCDuet-1 vector (P15A replicon, Chloramphenicol^R, from Novagen) by subcloning a synthesized NcoI-BamHI gene fragment (GenScript, Piscataway,
NJ, USA) carrying genes encoding NphT7 (acetoacetyl-CoA synthase from Streptomyces sp. CL190, GenBank ID: D7URV0.1) and Hbd (3-hydroxybutyryl-CoA dehydrogenase from Clostridium acetobutylicum ATCC 824, GenBank ID: P52041.2) into a synthesized pACYC construct harbouring crt (3-hydroxybutyryl-CoA dehydratase from C. acetobutylicum ATCC 824, GenBank ID: P52046.1) and ter (trans-2-enoyl-CoA reductase from T. denticola ATCC 35405, GenBank ID: Q73Q47.1).

pACYC-AHCT

pACYC-AHCT is a pACYCDuet-1 vector (P15A replicon, Chloramphenicol^R, from Novagen) with atoB (Acetyl-CoA acetyltransferase from E. coli, GenBank ID: P76461.1), hbd (3-hydroxybutyryl-CoA dehydrogenase from C. acetobutylicum ATCC 824, GenBank ID: P52041.2), crt (3-hydroxybutyryl-CoA dehydratase from C. acetobutylicum ATCC 824, GenBank ID: P52046.1) and ter (trans-2-enoyl-CoA reductase from T. denticola ATCC 35405, GenBank ID: Q73Q47.1) genes inserted in the order. Gene atoB (acetyl-CoA acetyltransferase from E. coli, GenBank ID: P76461.1) was PCR-amplified from E. coli K-12 purified genome, using primers 5?-attaggtaccAAAAATTGTGTCATCGTCAGTGCGGTAC and
5?-attaaagcTTAATTCAACCGTTCAATCACCATCGCAAT, showing complementary regions in capital
letters. The atoB PCR fragment was then subcloned into pACYC-NHCT, thus replacing the KpnI-HindIII
fragment carrying NphT7, resulting pACYC-AHCT plasmid.

pET-AdhE2

The pET-AdhE2 plasmid was constructed in a pET-Duet vector (f1 origin, Ampicillin^R, from Novagen) with adhE2 by subcloning synthesized gene encoding AdhE2 (aldehyde-alcohol dehydrogenase, from
C. acetobutylicum ATCC 824, GenBank ID: Q9ANR5) from a pUC57 parent vector provided by GenScript into
pET-Duet vector, using restriction sites NcoI and AvrII.

pCDF-ADO and pCDF-ADO_A134F

The pCDF-ADO plasmid was constructed in a pCDFDuet-1 vector (CDF replicon, streptomycin/spectinomycin^R, from Novagen) with ADO (aldehyde deformylating oxygenase from Prochlorococcus marinus MIT9313, GenBank ID: Q7V6D4.1) cloned into the vector using NcoI and EcoRI restriction
sites. The pCDF-ADO_A134F vector was created by mutating the ADO insert, using A134F_forward (5?-GCA TTT GCG
ATT TCT TTT TAT CAT ACG TAC-3?) and A134F_reverse primers (5?-GTA CGT ATG ATA AAA AGA AAT CGC AAA TGC-3?). The correct mutations were confirmed by complete plasmid
DNA sequencing. Gene encoding ADO was originally provided by E. Neil G. Marsh (Department
of Biological Chemistry, University of Michigan, USA) in a pET28b-cAD vector which
was used for the previous study 30].

pCDF-Ahr

The pCDF-Ahr plasmid was constructed in a pCDFDuet-1 vector (CDF replicon, streptomycin/spectinomycin^R, from Novagen). Gene encoding Ahr (aldehyde reductase from E. coli GenBank ID: P27250.2) was PCR-amplified from isolated E. coli K-12 genomic DNA, using primers 5?ATTAATCCATGGTCTAGATAATTAATGGATCCAGGAGGAAACATATGTCGATGATAAAAAGCTATGCCGCAAAAG-3?
and 5?-ATTAATCCTAGGAAGCTTCTCGAGTCAAAAATCGGCTTTCAACACCACGCGG-3?, and cloned into using
restriction sites NcoI and AvrII 8].

pRSF-PetF

The pRSF-PetF plasmid was constructed in a pRSF-Duet1 vector (RSF replicon, Kanamycin^R, from Novagen) with fdx (ferredoxin from Synechocystis sp. PCC 6803, GenBank ID: WP_010873424.1) by subcloning synthesized gene from a pUC57
parent vector provided by GenScript into a pRSF-Duet1 vector using NcoI and AvrII
restriction sites.

Co-expression and introduction of the pathway in E. coli

The atoB–adhE2 route was introduced into E. coli or the knockout cells by co-expressing pACYC-AHCT and pET-AdhE2 vectors. The atoB–TPC7 route was introduced into E. coli or the knockout cells by co-expressing pACYC-AHCT and pET-TPC7 vectors. The nphT7–adhE2 route was introduced into E. coli or the knockout cells by co-expressing pACYC-NHCT and pET-AdhE2 vectors. The nphT7–TPC7 route was introduced into E. coli or the knockout cells by co-expressing pACYC-NHCT and pET-TPC7 vectors in the cells.

E. coli cells containing engineered pathways were further engineered by co-transforming either
pCDF-ADO or pCDF-ADO_A134F vectors in order to introduce ADO or the ADO_A134F variant. The pRSF-PetF vector was co-expressed for Fdx, while pCDF-Ahr was used to
introduce Ahr enzyme in the pathway. The presence of all the proteins in each individual
plasmid was confirmed by SDS-PAGE and mass spectrometry analysis of the respective
SDS-PAGE bands. In the case of proteins with a hexahistidine tag, Western blotting
(using WesternBreeze Chemiluminescent Immunodetection kit from Invitrogen, Carlsbad,
CA, USA) was also used to analyse the expression of his-tagged proteins.

SDS-PAGE analysis of protein expression in cells containing plasmids encoding pathway
components

Protein expression levels in cells containing plasmids that encode the pathway enzymes
were examined by SDS-PAGE. T5 media (20 mL; 12 g tryptone, 24 g yeast extract, 4 mL
glycerol, 12.5 g K₂HPO₄, 2.3 g KH₂PO₄, 20 g glucose per litre) was inoculated with 1% (v/v) transformed E. coli cells and incubated at 37°C (180 rpm) until the optical density at 600 nm (OD_600nm) reached 0.5. Cultures were then induced with isopropyl ?-D-1-thiogalactopyranoside
(final concentration of 0.5 mM). Cultures were grown for a further 24 h at 30°C (180 rpm).
Samples (200 ?L) from the cultures were taken for SDS PAGE analysis. Samples were
taken before isopropyl ?-D-1-thiogalactopyranoside (IPTG) induction and after 4 or
24 h of IPTG induction and cells harvested by centrifugation. Samples were electrophoresed
in 12% RunBlue precast SDS-PAGE gels (Expedeon, Cambridge, UK). Protein bands were
visualized by staining with Instant Blue protein stain (Expedeon).

Media, cultivation and detection of propane and butanol

Lysogeny broth (LB) liquid media (10 mL) was inoculated using E. coli glycerol stocks (from ?80°C) and incubated at 37°C overnight at 180 rpm. Of T5 media,
50 mL (12 g tryptone, 24 g yeast extract, 4 mL glycerol, 12.5 g K₂HPO₄, 2.3 g KH₂PO₄, 20 g glucose per litre) was inoculated with 1% (v/v) of the inoculum and kept for incubation at 37°C (180 rpm) until the optical density
at 600 nm (OD₆₀₀) reached 0.5. The cultures were then induced with IPTG to a final concentration of
0.5 mM. The cell cultures were further grown for 4 h at 30°C and 180 rpm to prepare
the samples for propane detection. In the case of total butanol produced in the butanol
pathway, the culture was left at 30°C (180 rpm) for 72 h, while for residual butanol
detection, samples were taken from this culture when OD₆₀₀ reached 1.5. Control cultures were made using untransformed E. coli strain BL21 DE3 cells.

For propane formation analysis, 50 mL cell culture was centrifuged at 4,000 rpm, and
the supernatant was discarded. The cell pellets were resuspended in a 6.25-mL T5 media
with 0.5 mM IPTG, and 500 ?L of the resuspended culture was transferred into 2-mL
crimp sealed GC vial and used for propane analysis. The vials were incubated at 30°C,
with shaking at 180 rpm for 3 h. Headspace of 1.0 mL from the cultures grown in the
GC vial was manually removed and injected into the GC with a gas tight syringe. Propane
detection was carried out using a Varian 3800 GC (Palo Alto, CA, USA) equipped with
a DB-WAX column (30 m?×?0.32 mm?×?0.25 ?M film thickness, JW Scientific, Santa Clara,
MA, USA). The injector temperature was 250°C with a split ratio of 10:1. The column
temperature was set from 40°C hold for 2 min to 100°C at 20°C/min with helium flow
at 1 mL/min and FID temperature at 250°C. Propane peak was identified by comparing
it with the analytical propane standard, and quantification was done using a propane
calibration curve.

For residual butanol detection, 50 mL liquid culture was spun down at 4,000 rpm for
10 min. Of the supernatant, 500 ?L was extracted with 500 ?L of ethyl acetate containing
0.2% hexane as internal standard and dried over MgSO₄. Of the sample, 1 ?L was analysed in GC using a Varian 3800 GC equipped with a HP-5
column (30 m?×?0.32 mm?×?0.25 ?M film thickness, JW Scientific). The injector temperature
was 250°C with a split ratio of 20:1. The column temperature was set from 40°C hold
for 1 min to 280°C at 20°C/min with helium flow at 1 mL/min and FID temperature at
250°C. Butanol peak was identified by comparing with the analytical butanol standard,
and quantification was done using a butanol calibration curve.