A novel quantitative real-time polymerase chain reaction method for detecting toxigenic Pasteurella multocida in nasal swabs from swine

Progressive atrophic rhinitis (PAR) in pigs is caused by toxigenic Pasteurella multocida (capsule types A and D) which synthesize a 145-kDa toxin (dermonecrotic toxin) [1] encoded by the chromosomal toxA gene [2, 3]. PAR is of worldwide economic importance to swine production due to a reduction in growth rate in fattening pigs. In Switzerland, PAR is monitored in about 90% of the Swiss primary nucleus and secondary multiplying herds by annual bacteriological examination of 10 nasal swabs per herd for toxigenic P. multocida. Swabs are analysed by culturing the swabs on selective agar [4] and subsequent screening of bacterial colonies for toxigenic P. multocida by polymerase chain reaction (PCR) [5]. During a recent outbreak of PAR in Swiss multiplying herds [6], nasal swabs from feeder pigs were tested for toxigenic P. multocida by the method outlined above. A panel of 203 nasal swabs from this PAR outbreak were further used to evaluate a novel quantitative real-time PCR (qRT-PCR) for toxigenic P. multocida in porcine nasal swabs. The bacterial strains used in this study are given in Table 1. Strains were grown on 7% sheep blood agar aerobically at 37 °C for 24 h (PB5008A, Oxoid, Pratteln, Switzerland).

Reference strains used in this study

Organism

Strain

Source

toxA gene

Pasteurella multocida ssp. multocida

ATCC 12948

Pig

+

Pasteurella multocida ssp. multocida

ZH 1760

Pig nose

+

Pasteurella multocida ssp. multocida

ZH 17056-18

Pig nose

+

Pasteurella multocida

ZH 2232

Pig nose

+

Pasteurella multocida

ZH 148

Sheep lung

+

Pasteurella canis

ZH 401

Cat wound

+

Pasteurella multocida ssp. multocida

ATCC 43137

Pig

–

Pasteurella canis

ATCC 43326

Dog throat

–

Pasteurella multocida

ZH 1950

Pig nose

–

Pasteurella multocida

ZH 1949

Pig nose

–

Pasteurella multocida

ZH 17430

Cow lung

–

Pasteurella multocida

ZH 1615

Cow nose

–

Nasal swabs were collected from a total of 203 feeder pigs on farms affected by PAR [6]. Cotton swabs were transported in Amies medium in screw cap plastic vials (VWR, Dietikon, Switzerland) to the lab. Swabs were streaked onto selective blood agar plates according to Rutter et al. [4] (PB5175A, Oxoid, Switzerland), incubated for 24 h at 37 °C under 5% CO₂. From each agar plate Pasteurella-like colonies or if necessary an arbitrarily taken fraction from the bacterial lawn were subjected to DNA extraction.

Genomic DNA was released by heat lysis of bacterial colonies resuspended in water on a thermal shaker for 10 min at 99 °C. After centrifugation at 17,000g for 3 min the supernatant was transferred into a fresh tube and stored at –20 °C until further use. Bacteria from nasal swab cultures were processed accordingly.

Primer and probes were selected using Primer Express Software v3.0.1 (Applied Biosystems, Zug, Switzerland) from alignments of the available sequences of the P. multocida toxA gene (GenBank accession numbers: AF240778.1, AY864768.1, EF441531.1, X51512.1, X52478.1 and FN398148.1). According to pairwise comparison of the toxA gene the percent identity were between 99.76 and 100% underlining its high degree of conservation. The primers selected amplify a conserved 86 base pair (bp) fragment within the 3858 bp toxA gene (GenBank accession number: AF240778.1) between nucleotides 2097 and 2182 (Table 2).

Primer and probe sequences with their respective dye and quencher used for the qRT-PCR

Gene specificity of both primers and the probe were confirmed by BLAST searches. Primers were synthesized by Microsynth (Balgach, Switzerland). DNA probes were supplied by Eurogentec S.A. (Seraing, Belgium). The probes were quenched by black-hole non-fluorescent quenchers at the 3?-end. Rox dye (Life Technologies, Darmstadt, Germany) was used as an internal reference for normalization and data analyses. An internal amplification control (IAC) was introduced for monitoring each reaction, since bacterial lysates could contain inhibitory substances. Five femtogram (fg) of the pEGFP-1 strandard vector (BD Bioscience Clonetech, USA) was used as IAC template, and a 177 bp amplicon [7] was amplified with primers and the probe given in Table 2. DNA (1 pg) from a toxA-positive and a-negative P. multocida reference strain (ATCC 12948, ATCC 43137) were used as controls in each qRT-PCR run.

The qRT-PCR was performed on an ABI 7500 Fast Real-Time PCR Instrument (Applied Biosystems) using the Path-ID™ qPCR Master Mix (2×) (Life Technologies). Each reaction contained 5 µl master mix, 200 nM of each eGFP-1-F and eGFP-10-R primer [7], 1 µl IAC eGFP plasmid DNA (5 fg), 25 nM ATTO 647 N-labeled eGFP probe, 400 nM of each toxA-F and toxA-R primer, 200 nM FAM labeled toxA probe, 2 µl template DNA and nuclease free water to a final reaction volume of 10 µl.

Cycling conditions were 10 min at 95 °C, followed by a two-step cycling stage of 40 cycles of 15 s at 95 °C and 60 s at 60 °C. Data analysis was handled by the 7500 Software version 2.0.4 (Life Technologies). Samples were considered positive when presenting a typical amplification curve with a Ct value of ?38 for toxA and a Ct value of ?32 for the IAC. Analyses of samples with IAC Ct values 32 were repeated after reduction of PCR-inhibitory substances by 1:2 and 1:10 dilution.

With an estimated genome size of 2.26 Mb a DNA quantity of 2.5 fg was calculated for one genome equivalent (GE) of P. multocida [8]. The efficiency of the qRT-PCR was determined by plotting standard curves (Ct values against quantified GE) in 10-fold dilution from 2 × 10⁷ to 2 × 10³ GE. The slope of the linear relationship of this curve was used to calculate the amplification efficiency [9]. To determine the minimum detectable bacterial concentrations for the qRT-PCR, twelve replicates of a DNA dilution series containing 4000, 400, 40, 20, 10, 5 and 2 GE of P. multocida ATCC 12948 per 10 ?l PCR reaction were analysed. As illustrated in Table 3, the limit of detection (LOD) was determined to be 10 GE, the lowest dilution for which the acceptance criteria (Ct 38 and a standard deviation of 0.5) were fulfilled.

Determination of the LOD of the qRT-PCR

Ct values using DNA template of the P. multocida ATCC 12948 reference strain and its standard deviation (SD) of a series of 12 replicates were determined for each dilution step ranging from 2 to 4,000 genome equivalents. A Ct values of the toxA measured by the FAM detection channel are represented whereas in (B) Ct values of the internal amplification control measured by the Cy5 detection channel are shown

The sensitivity of both the qRT-PCR and the conventional PCR assays was confirmed by testing toxA-positive P. multocida strains. The specificity of the qRT-PCR was confirmed by analysis of 32 different bacterial species (Additional file 1).

An amplification plot of a dilution series of toxA was created (Additional file 2). The efficiency of the qRT-PCR was determined by the use of serial dilution standard curves. The linear correlation coefficient r² for the toxA gene target was 0.999, showing a high degree of linearity of the qRT-PCR. Based on the slope of the standard curve (–3.348), the amplification efficiency was calculated as 98.9%. At DNA template amounts 1?g, the eGFP amplification was reduced and was completely inhibited with 1.8 ?g template DNA. For diagnostic application of the qRT-PCR, a DNA template of maximum 1 ?g DNA template was used. To determine the LOD of the assay the acceptance criteria of Ct  38 and a standard deviation of 0.5 were used. With a LOD of 10 GE, the qRT-PCR showed a tenfold higher sensitivity than the conventional PCR with a LOD of on average 100 GE per PCR reaction [5]. The specificity of both PCR assays was confirmed by repeated test of toxA-positive P. multocida strains. The panel of 32 heterologous bacteria scored negative (Additional file 1). Overall, the qRT-PCR assay revealed a high precision as confirmed by the inter- and intra-assay coefficient of variations (CV) of the Ct values of the positive control as well as the IAC from 52 independent PCR runs. The CV inter-assay values were 5.9% for toxA and 2.7% for IAC; the intra-assay CV values were 1.1% for toxA and 0.58% for IAC.

By comparative analysis of 203 nasal swabs from pigs suspected for PAR, 90 samples (44.3%) were identified as toxA gene-positive by both PCR protocols. A sample of 11 swabs (5.4%) were identified as toxA gene-positive by qRT-PCR (Ct values 16–33.5), whereas the conventional PCR revealed unevaluable results (e.g. several PCR amplifications products of different but unexpected sizes) despite the positive and negative control reactions performed as expected. Overall, the qRT-PCR detected toxA-positive P. multocida in 101 swabs (49.8%). By comparison, the conventional PCR was less sensitive with 90 samples (44.3%) identified as toxA-positive P. multocida.

Noteworthily, a Pasteurella canis strain from the skin wound of a cat was identified as toxA-positive by our novel qRT-PCR. This finding was verified by two independent PCR reactions: Species identification was confirmed by the P. canis-specific PCR of Krol et al. [10], targeting sodA, a housekeeping gene encoding manganese-dependent superoxide dismutase. In addition to the PCR species identification, strain ZH 401 was confirmed as P. canis by MALDI-TOF analysis. Moreover, a partial fragment of toxA from P. canis ZH 401 has been sequenced and shows a few point mutations in comparison to the highly conserved sequences of toxA-positive P. multocida strains (Additional file 3). The presence of toxA in our feline P. canis was confirmed with an in-house toxA-PCR (primer 34_ToxA 5? ACTGTAAAAGGAAAAAGTGCCGATG 3? and 35_ToxA_rev 5? AAGAGGAGGCATGAAGAGTGC 3?) resulting in a 3792 bp toxA specific amplicon. The expression of toxA in strain ZH 401 was confirmed with the aid of a P. multocida toxin (PMT) ELISA (Oxoid, Pratteln, Switzerland). The finding of toxA in other bacteria than P. multocida is of particular interest. Since toxA is encoded within a lysogenic prophage, it may be transferred to other bacteria (as in our case to P. canis) by transduction [11].

To conclude, our novel qRT-PCR is highly efficient and robust to diagnose toxA-positive P. multocida in nasal swabs. Compared with the conventional PCR, the qRT-PCR is more sensitive and specific and time saving. This qRT-PCR will facilitate large scale screening to monitor PAR in swine populations.