Patterned polymer matrix promotes stemness and cell-cell interaction of adult stem cells

Materials

All reagents were purchased from Sigma-Aldrich (St. Louis, MO) at the highest available
quality unless otherwise noted.

Culture substrate fabrication

For this work, a one millimeter thick, double side polished fused silica wafer (Mark
Optics, Santa Ana, CA) was diced into 22 mm by 22 mm square chips. Each chip was patterned
with a single 10 mm by 10 mm array of nanopores using the femtosecond laser machining
system 29]. Each array was patterned with a unique pore-to-pore spacing value, determined by
the choice of laser beam raster, laser pulse repetition rate and laser beam scanning
rate. Each nanopore was formed by a single 790 nm wavelength, 160 femtosecond laser
pulse focused on the surface of the fused silica chip using a dry microscope objective
(Nikon CF Plan Achromat 79173) with a numerical aperture (NA) of 0.85 and spherical
aberration correction collar set to 0.17 mm. The as-processed fused silica molds were
soaked in aqueous KOH at 90 °C to remove femtosecond laser ablation debris and also
to enlarge the diameter of the nanopores. The etched molds were rinsed then soaked
in deionized water at 90 °C for 2 h to remove residual KOH, and finally dried under
a stream of dry nitrogen.

To facilitate the release of polymer fibers from the mold, all fused silica molds
were silanized with 1H1H2H2H Perfluorodecyltrichlorosilane (FDTS) (Alfa Aesar, Ward
Hill, MA). First the molds were conditioned in a 1:1 mix of HCl:methanol for 30 min.
The molds were then rinsed in methanol, dried under a stream of dry nitrogen, and
finally exposed to FDTS vapors inside a 200 millitorr desiccator for 12 h. FTDS molecules
bind to –OH terminated surfaces and form self-assembled monolayers that reduce surface
energy and prevent sticking.

Each mold listed in Table 1 was used to prepare PCL nanofiber culture models via hot-pressing. A piece of PCL
film, formed by compression of PCL pellets, is placed between a fused silica mold
and a 22 mm by 22 mm by 0.25 mm HybriSlip HS22-CS polycarbonate (PC) backing slide
(Grace Bio-labs, Bend, OR). This three-element stack is prepared atop a 3 mm thick
fused silica flat blank seated at the center of the press (Fig. 1). With all the elements of the press stacked together, the spring-loaded pneumatic
plunger is actuated progressively to a pressure of 45 psi, pressing the pressure ball
against the stack. The Chrome-Nickel heating elements inside the heating blocks are
turned on, and the temperature of the cooling elements (monitored using a pair of
thermocouples) is raised to and held at 80 °C for 5 min. During this period, the PCL
melts and infiltrates the nanopores of the mold. The heating elements are then turned
off, and the press allowed to cool to 50 °C by air convection. Once the temperature
of the cooling elements reaches 50 °C, rapid cooling to room temperature is forced
by circulating cold water through the cooling elements. Once room temperature is reached,
the plunger is allowed to pull back to its idle position. The mold-PCL-PC stack is
removed from the press, and PCL-PC is gently peeled-off the mold. The PCL adheres
strongly to the PC backing, making it easy to handle.

Flat PCL substrates were formed by the press apparatus, and spin-coated control-substrates
were formed by a spin-coating apparatus (Laurell Technologies, North Wales, PA, USA).
For spin-coated substrates 15 mm circular glass cover slips (Fisher Scientific) were
first cleaned with 100 % ethanol, rinsed with deionized water, and heated to 80 °C
for ~20 min to dry. A 1 % weight/volume (w/v) solution of PCL in tetrahydrofuran (THF)
was spun for 30 s at 3000 RPM atop the clean glass cover slip (50 ?l polymer solution/sample).

Substrate characterization

For scanning electron microscopy (SEM) imaging of polymer fibers, we used JEOL JSM-6320 F
scanning electron microscope (JEOL, Tokyo, Japan). Samples for SEM imaging were prepared
by cross sectioning PCL on PC substrates with a razor blade. To prevent PCL films
from charging during SEM imaging, every sample was sputter-coated with a 20–30 nm
thick gold film using a Bio-Rad Polaron SEM coating system E5150 with film thickness
control (Quorum Technologies, UK). Polymer fiber dimensions were measured using ImageJ
(NIH, Bethesda, MD). During the mold fabrication process, the laser pulse creates
an entrance hole in the mold that has a larger diameter than the majority of the hole.
This results in a wider base on each polymer fiber that is 1–2 ?m in height. These
bases were excluded from the fiber diameter measurement. Fifteen diameter measurements
were performed on two images per each polymer fiber mold. These measurements include
the sputter coating thickness. The height of fibers above the base was measured by
optical microscopy. A 50x objective was focused, at first, on the substrate, and then
translated vertically until the tops of the fibers were in focus. The translation
distance was measured on a micrometer. Focus was verified using brightfield and darkfield
functions. Optical height measurements are consistent with SEM imaging.

Cell culture

hMSCs were purchased from Lonza (Walkersville, MD). All cell experiments used hMSCs
at passage 5. hMSCs were cultured in alpha-minimum essential media with nucleosides
(Life Technologies, Carlsbad, CA), 16.7 % heat-inactivated fetal bovine serum (Life
Technologies), 1 % penicillin/streptomycin (Life Technologies), and 4 ?g/ml plasmocin
prophylactic agent (InvivoGen, San Diego, CA). Cells were grown in a humidified incubator
at 37 °C and 5 % CO
₂
. Media was replaced every 3 days. hMSCs, were detached from tissue culture flasks
at around 80 % confluence with 0.05 % trypsin-EDTA and passaged at 100–500 cells/cm
²
. For all cell experiments, hMSCs were seeded on substrates at a density of 10,000
viable cells/cm
²
. Cell media was replaced after 72 h.

Quantitative real-time polymerase chain reaction (qPCR)

Cells cultured on polymer fiber films and TCPS control wells were homogenized with
Trizol reagent (Life Technolgies), mixed with chloroform (1:5 Trizol:chloroform),
and separated by centrifugation (12,000x g, 15 min, 4 °C). The aqueous phase containing
RNA was isolated using RNeasy columns (Bio-Rad, Hercules, CA) according to the manufacturer’s
instructions. RNA concentration was determined using a TECAN M1000 plate reader with
the manufacturer’s software. cDNA was synthesized using a cDNA generation kit (Applied
Biosystems, Life Technologies, Carlsbad, CA) and qPCR was performed using SYBR Green
master mix kit (Bio-Rad) with 15 ng cDNA and 500 mM each of forward and reverse primers.
Primer sequences were the following: Nanog (NM_024865.2) forward ‘AATACCTCAGCCTCCAGCAGATG’
and reverse ‘TGCGTCACACCATTGCTATTCTTC’; OCT4A (NM_002701.4) forward ‘CCTTCGCAAGCCCTCATTTCAC’
and reverse ‘GGAAGCTTAGCCAGGTCCGA’; ITGA2 (NM_002203.3 forward ‘TTAGCGCTCAGTCAAGGCAT’
and reverse ‘CGGTTCTCAGGAAAGCCACT’; PECAM (NM_00442.4) forward ‘CCAAGCCCGAACTGGAATCT’
and reverse ‘CACTGTCCGACTTTGAGGCT’; and GAPDH (NM_002046.4) forward ‘GCACCGTCAAGGCTGAGAAC’
and reverse ‘TGGTGAAGACGCCAGTGGA’. A CFX Real-Time PCR System (Bio-Rad) was run with
the qPCR protocol: 95 °C for 3 min, followed by 40 cycles of denaturation at 95 °C
for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 30 s. Expression
of each gene measured was normalized to the expression of glyceraldehyde 3-phosphate
dehydrogenase (GAPDH) as a housekeeping gene, thereby generating ?C(t) values, and
expression of 2
^-??C(t)
relative to the TCPS control. N?=?3 biological replicates per substrate condition were performed.

Immunocytochemistry

Cells cultured on the test substrates were fixed with 4 % paraformaldehyde (PFA) for
15 min at room temperature and permeabilized with 10 % goat serum with 0.3 % Triton-X
overnight at 4 °C. Cells were then incubated with Hoechst (2 ?g/ml) for 20 min at
room temperature, followed by Alexa488-phallodin (1:5 v/v in PBS, Life Technologies,
Carlsbad, CA) for 10 min. Imaging was performed with a Zeiss LSM 710 confocal microscope
(Carl Zeiss, Oberkochen, Germany) and images were process with Zeiss Zen software
and ImageJ (NIH, Bethesda, MD).