Wild type human TDP-43 potentiates ALS-linked mutant TDP-43 driven progressive motor and cortical neuron degeneration with pathological features of ALS

Ethics statement

All experiments were performed under the terms of the UK Animals (Scientific Procedures)
Act 1986, and were approved by the Kings College, London ethics review panel.

Generation of transgenic animals

Construction of transgenic mice expressing TDP-43
^WT
(line 96) or TDP-43
^Q331K
(line 31) has been previously described (see Additional file 1: Figure S1 in reference 36]). Briefly, cDNAs containing N-terminal myc-tagged full length wild-type or Q331K
mutant TDP-43 were amplified by PCR to insert flanking SalI digestion sites. The resulting
products were digested by SalI and cloned into the XhoI insertion site of the MoPrP.
XhoI vector (ATCC #JHU-2). The resultant MoPrP. XhoI-mychuTDP-43 construct was then
digested upstream of the minimal PrP promoter and downstream of the final PrP exon
3 using BamHI and NotI and subcloned into a shuttle vector containing loxP flanking
sites (see Fig. 1a in reference 36]). The final construct was then linearized using XhoI, injected into the pro-nuclei
of fertilized C57Bl6/C3H hybrid eggs and implanted into pseudopregnant female mice.
After obtaining multiple founder mice, lines displaying comparable levels of mutant
or wild-type transgene accumulation were selected and backcrossed to C57Bl6 to establish
the lines detailed in this paper. The mice used for analysis were backcrossed to C57Bl6
for a minimum of four generations. All mice were maintained on a C57B6/J background,
and compound hemizygous animals were generated by crossing hemizygous TDP-43
^WT
animals with TDP-43
^Q331K
mutant expressing animals (TDP-43
^WTxQ331K
). Mice from the single hemizygous lines were identified using PCR with primers 5’-
GGATGAGCTGCGGGAGTTCT and 3’- GTCAACCCCATACTACCCGT. Animals from the compound hemizygous
lines were identified with direct sequencing using the primers 5’- ATGACTGAGGATGAGCTGCG
and 3’- GGATGCTGATCCCCAACCAA.

Fig. 1. Expression of TDP-43
^WT
and TDP-43
^Q331K
in mice decreases endogenous TDP-43 expression. a Western blotting of brain lysate from 8 week old non-transgenic (NTg), TDP-43
^WT,
TDP-43
^Q331K
, and TDP-43
^WTxQ331K
mice using an anti-TDP antibody showed a slight shift to a higher molecular weight
due to the presence of the myc tag. There was an increase in total TDP43 expression
in all transgenic animals, with higher expression in TDP-43
^Q331K
mice than TDP-43
^WT
animals, and TDP-43
^WTxQ331K
animals showing evidence of cumulative TDP43 expression (b). This increase was accompanied by a concomitant decrease in endogenous TDP43 expression
(c). d–k Immunohistochemistry with anti-myc antibody showed expression of the TDP-43 protein
throughout the spinal cord (d–g) and in the cortex (h–k; scale bar: 50 ?m) in TDP
^WT
(e, i), TDP
^Q331K
(f, j) and TDP-43
^WTxQ331K
(g, k) mice, which was absent in NTg animals (d, h) . (All graphs are mean?±?SEM; *p??0.05; **p??0.001 vs. NTg; †† p??0.001 vs. TDP
^WT
, ## p??0.001 vs. TDP
^Q331K
)

Evaluation of motor function and health

From 3 weeks of age, mice were regularly weighed and general health status was recorded.
Animals showing signs of hind-limb paralysis were monitored daily, and disease end
stage and death was defined as the time when animals could no longer obtain food or
water, or had lost 25 % of their body weight, at which point they were euthanized.

Motor strength and coordination were evaluated on the rotarod (Columbus Instruments)
at multiple ages (5 weeks, 3, 6, 12, 18 24 months), using a 5 min accelerating protocol
starting at 2 rpm, and rising to 30 rpm throughout the 5 min testing period. Mice
were tested on multiple occasions, and all animals received an initial training session
of 2 min at 2 rpm to acclimatise them to the equipment.

Data from 5 week old TDP-43
^WTxQ331K
mice and their littermates were assessed statistically by one-way analysis of variance
(ANOVA) followed by the Tukey test. All other data were assessed statistically by
two-way ANOVA followed by the post-hoc Holm-Sidak test.

Histology and immunohistochemistry

Eight week old, end stage TDP-43
^WTxQ331K
mice, and 24 month old single hemizygous mice and their respective age-matched littermates
were anaesthetised and transcardially perfused with PBS followed by 4 % paraformaldehyde
(PFA) in phosphate buffer. Brain, spinal cord and gastrocnemius muscles were postfixed
in 4 % PFA in 15 % sucrose for 5 h, cryoprotected in 30 % sucrose for 24 h and cut
into 30 ?m (brain and cord) or 40 ?m (muscle) sections on a cryostat.

For immunohistochemistry, the following antibodies were used: rabbit anti-TDP-43 (1:500,
Proteintech), rabbit anti-mouse TDP-43 (0.1 ?g/ml, a gift from Prof. Virginia Lee
(Igaz et al. 2011)), rabbit anti-ubiquitin (1:1000, DAKO), rat anti-myc (1:1000, Serotec),
rabbit anti-GFAP (1:4000, DAKO), mouse anti-CD68 (1:2000, Serotec), rabbit anti-p62
(sequestosome 1) (1:10,000; Abcam). For bright field imaging, sections were washed
and incubated with the appropriate biotinylated secondary antibody (1:1000, Vector),
and then with an ABC kit (Vector). Sections were imaged using a Zeiss light microscope
and Axiovision software. For fluorescence imaging, sections were incubated with rat
anti-myc (1:200) and either rabbit anti-ubiquitin (1:200) or rabbit anti-p62 (1:5000),
sections were washed and incubated with goat anti-rat Alexa Fluor 488 and goat anti-rabbit
AlexaFluor 568 (Invitrogen), and imaged using a Leica confocal microscope and LAS-AF
software.

For motor neuron counts, perfused lumbar spinal cords from 3 to 4 animals per genotype
were serially sectioned, and every 6th section (30 ?m) was analysed. Sections were
mounted, dried, incubated overnight in 1:1 ethanol/chloroform to de-fat the sections,
stained for 10 min in warm 0.1 % cresyl violet, dehydrated and coverslipped. To compare
the number of motor neurons, large neurons greater than 30 ?m in diameter (as assessed
using the integrated morphometry analysis package in Metamorph 7.7, Molecular Devices,
Wokingham, UK) in the anterior horn of the lumbar spinal cord were counted in 15 sections.
Data were assessed statistically by one-way ANOVA, followed by the post-hoc Tukey
test. For cortical neuron counts, perfused brains from 3 to 4 animals per genotype
were serially sectioned, and every 12th section (30 ?m) through the motor cortex was
assessed. Sections were stained as for the lumbar spinal cord. To compare the number
of neurons, cells greater than 5 ?m in diameter (as assessed using the nuclear count
analysis package in Metamorph) were counted in four images per section. Data were
assessed statistically by one-way ANOVA, followed by the post-hoc Tukey test.

For muscle histology, gastrocnemius muscles (2–4 animals per age and genotype) were
dissected fresh, immediately frozen in isopentane cooled in dry ice, and cryostat
sections were cut onto slides and stained with haematoxylin and eosin. For the detection
of neuromuscular junctions (NMJs), perfused gastrocnemius muscle (2–3 animals per
age and genotype) was incubated in Alexa Fluor 555 ?–bungarotoxin (1:500, Life Technologies) and rabbit anti-Synaptophysin 1 (1:500, Synaptic
Systems). Sections were washed and incubated in donkey anti-rabbit IgG DyLight 488
secondary antibody (1:500, Thermo Scientific) and imaged on a Leica confocal microscope.
To assess NMJ area, the total area stained by bungarotoxin was assessed in ImageJ,
in 30–40 NMJs per animal. To calculate the number of intact NMJs, 70–100 were assessed
per animal, and were considered intact if they demonstrated full colocalisation of
bungarotoxin and synaptophysin staining. Data were assessed statistically by one-way
ANOVA, followed by the post-hoc Tukey test.

Nerve root axon count

7 week old, end stage TDP-43
^WTxQ331K
mice (n?=?3–4 per genotype), and 24 month old single hemizygous mice (n?=?3–6 per
genotype) and their respective age-matched littermates were anaesthetised and transcardially
perfused with PBS followed by a mixture of 2 % PFA and 2.5 % glutaraldehyde in 0.1 M
cacodylate buffer. The L5 ventral roots were removed and post fixed in the same fixative
at 4 °C overnight. The roots were then further fixed in 1 % osmium tetroxide in0.1 M
cacodylate buffer for 4 h. Fixed tissue was then dehydrated in ethanol and embedded
in Epox 812/Araldite 502 (TAAB). semi-thin sections (0.65 ?m) were cut using an ultramicrotome
(Reichart-Jung Ultracut-E) and collected onto glass slides. The sections were stained
with 1 % toluidine blue for 15 s before mounting for viewing and examined under a
light microscope. Axon measurements were made using the integrated morphometry package
on Metamorph 7.7 (Molecular Devices, Wokingham, UK) and ?-motor axons, defined as
those with a diameter greater than 3.5 ?m, were counted. Data was analysed statistically
by way of ANOVA followed by the post-hoc Tukey test.

Immunoblotting

To assess expression levels of full length TDP-43, the 25 and 35 kDa TDP-43 fragments,
and phospho-TDP-43, whole brains of 3–4 end stage hTDP
^WTxQ331K
and 3–4 age-matched hTDP
^WT
, hTDP
^Q331K
and non-transgenic animals, were lysed in low salt buffer (10 mM Tris, 5 mM EDTA,
10 % sucrose) with protease inhibitors (Roche Diagnostics, UK). Total TDP-43 levels
were also assessed in four 24 month old hTDP
^WT
, hTDP
^Q331K
and non-transgenic animals.

For cytoplasmic and nuclear fractionation, four brain samples for each age and genotype
were prepared as described earlier 42]. Briefly, snap-frozen tissue was weighed and homogenised in buffer containing 10 mM
Hepes, 10 mM NaCl, 1 mM KH
₂
PO
₄
, 5 mM NaHCO
₃
, 5 mM EDTA, 1 mM CaCl
₂
, 0.5 mM MgCl
₂
and protease inhibitors (10x vol/weight). After 10 min on ice, 2.5 M sucrose (0.5x
vol/weight) was added. Tissue was homogenized and centrifuged at 6300 g for 10 min.
The supernatant was collected as the cytoplasmic fraction. The pellet was washed four
times in TSE buffer (10 mM Tris, 300 mM sucrose, 1 mM EDTA, 0.1 % IGEPAL (Sigma) and
protease inhibitors 10x vol/weight), homogenized and centrifuged at 4000 x g for 5 min. Finally the pellet was resuspended in RIPA buffer with 2 % SDS (5x vol/weight)
as the nuclear fraction.

For insolubility assessment, four brain samples for each age and genotype underwent
sequential extraction in buffers of increasing stringency, based on a modified protocol
previously described 43]. Briefly, snap-frozen tissue (500 mg/ml w/v) was extracted by repeated homogensiation
and cetrifugation steps (120,000 g, 30 min 4 °C) in high salt buffer (50 mM Tris–HCl,
750 mM NaCl, 10 mM NaF, 5 mM EDTA, pH7.4), 1 % Triton X-100 in high salt buffer, RIPA
buffer (50 mM Tris–HCl, 150 mM NaCl, 5 mM EDTA, 1 % NP-40 substitute, 0.5 % sodium
deoxycholate, 0.1 % sodium dodecyl sulphate) and urea buffer (30 mM Tris HCl pH 8.5,
7 M Urea, 2 M Thiourea, 4%CHAPS). To prevent carry over, each extraction step was
performed twice. Supernatants from the first extraction steps were analysed, while
supernatants from the wash steps were discarded. Protease inhibitors were added to
all buffers excluding the urea buffer prior to use.

Protein samples were then separated by SDS/PAGE using 10 % polyacrylamide gels, and
transferred to nitrocellulose membranes. Total TDP-43 and the 25 and 35 kDa fragments
were recognised by a rabbit polyclonal antibody to TDP-43 (1:1000, Proteintech), and
exogenous myc tagged human TDP-43 was recognised by a mouse monoclonal antibody to
the myc tag (1:1000, Cell Signalling). Phospho-TDP-43 was recognised using a rabbit
anti-phospho-Ser409/410-TDP-43 (1:1000, CosmoBio), and in these analyses, total TDP
was recognised using a rat monoclonal antibody to TDP-43 (1:1000, BioLegend) . Fluorescent
secondary antibodies conjugated to Dylight 680 nm or 800 nm (Thermo Scientific) were
used to detect protein levels, and results were visualised using the Odyssey Imager
(Licor). Data were normalised to GAPDH (1:5000, Sigma), actin (1:20,000, Abcam) or
Lamin B1 (1:2000, Abcam). Quantitation of immunoblots was done using Image J software,
and data were analysed statistically by way of ANOVA followed by the post-hoc Tukey
test.