Yes-associated protein (YAP) is a negative regulator of chondrogenesis in mesenchymal stem cells
Cell isolation and culture
Human MSCs were obtained according to the declaration of Helsinki with ethical approval
from the North of Scotland Research Ethics Committee. MSCs from human synovial membrane
(hSM) or periosteum were isolated from specimens obtained post-mortem in the Laboratory
for Skeletal Development and Joint Disorders, University of Leuven, Belgium, or following
joint arthroplasty for OA after informed consent from patients, and expanded up to
passage (p)3 as previously described 6],25], then routinely seeded at 2,000 cells/cm2. In addition, MSCs were isolated from human bone marrow, after consent from donors,
in the Laboratory for Skeletal Development and Joint Disorders, University of Leuven,
Belgium, or from iliac crest-derived bone marrow mononuclear cells purchased from
Stemcell Technologies (Vancouver, BC, Canada), and routinely seeded at 3,000 cells/cm2. Human MSCs were used for experiments up to p8. The murine MSC-like cells (embryonic
fibroblast line, C3H10T1/2 clone 8) were purchased from the American Type Culture
Collection (Manassas, VA, USA), and maintained in alpha minimum essential medium (?MEM)
supplemented with 4 mM L-glutamine and 10% foetal bovine serum (FBS).
Chondrogenesis assay
In vitro chondrogenesis was performed using micromass culture by seeding 4 × 105 cells in 20 ?l droplets, as previously described 25]. Chondrogenic differentiation of human MSCs was induced by treatment with 10 ng/ml
of transforming growth factor ?1 (TGF-?1; Gibco, Life Technologies, Paisley, UK) in
a chemically defined serum-free medium starting 24 h after seeding 25]. In mouse C3H10T1/2 cells, chondrogenesis was induced by treatment with recombinant
human BMP-2 (Source Bioscience, Nottingham, UK) at 300 ng/ml in Dulbecco’s modified
Eagles’s medium (DMEM) (4.5 g/l glucose) in the presence of 10% FBS and 50 ?g/ml ascorbic
acid 26], or 10 ng/ml of TGF-?1 in DMEM (4.5 g/l glucose) in the presence of 10% FBS, starting
3 h after cell seeding. Micromass cultures were analysed 7 days after seeding, unless
otherwise indicated.
Plasmids and retroviral transduction
hYAP1, hYAP1(S127A), hYAP2, and hYAP2(S127A) cDNAs were sub-cloned from bacterial
expression vectors (Addgene (Cambridge, MA, USA) plasmids 17791, 17790, 17793 and
17794, respectively; 27]) into pMSCV-IRES-eGFP plasmids 28], as previously described 14]. Retroviruses were packaged in HEK293T cells using standard methods, and C3H10T1/2
cells (seeded the previous day at 15,000 cells/cm2) were incubated with viral supernatant in the presence of 4 ?g/ml polybrene for 4
h. Transduction efficiency was monitored by eGFP fluorescence, and was typically 90%
as determined by flow cytometry.
BMP-2 treatment
To determine the effects of YAP on BMP signalling, C3H10T1/2 cells were seeded in
micromass (4 × 105 cells in 20 ?l) and cultured overnight in DMEM (4.5 g/l glucose) supplemented with
1 mg/ml recombinant human insulin, 0.55 mg/ml transferrin, 0.5 ug/ml sodium selenite,
50 mg/ml bovine serum albumin (BSA), and 470 ug/ml linoleic acid (ITS+). The next
day, medium was replaced with medium containing 300 ng/ml BMP-2 (dissolved in 20 mM
acetic acid, pH 3.2) or vehicle, and protein or RNA was extracted 0.5 to 8 h later.
RNA extraction, cDNA synthesis, and quantitative polymerase chain reaction (PCR)
Total RNA was extracted using TRIzol reagent (Invitrogen, Paisley, UK) according to
standard protocols, and RNA was quantified using a NanoDrop ND-1000 spectrophotometer
(Labtech, Uckfield, UK). cDNA was synthesised from up to 2 ?g total RNA using random
hexamer primers and SuperScript II Reverse Transcriptase (Invitrogen), according to
the manufacturer’s instructions. Quantitative PCR (qPCR) was performed with a Roche
LightCycler 480 using Taqman Probes Master (Roche, Basel, Switzerland) for Sox9, Col2a1
and Col10a1, or SYBR Green Master (Roche) for all other assays, according to the manufacturer’s
instructions. Amplification of a single product of correct size was confirmed by agarose
gel electrophoresis and/or melting curve analysis. Relative concentrations were quantified
using a serially diluted standard curve of unknown target concentration, or calculated
using the Pfaffl method 29], and normalised to expression of GAPDH or ACTB. Results were expressed as relative
change from appropriate control or baseline. Primers were designed using Primer-BLAST
(National Center for Biotechnology Information) or Universal ProbeLibrary software
(Roche). Primer sequences (5? to 3?) that were used are: hYAP-Fw1: CCTCTTCCTGATGGATGGGAAC;
hYAP-Fw2: ACTCGGCTTCAGCCATGAAC; hYAP-Fw3: AGCCCACTCGGGATGTAACTTGA; hYAP-Fw4: ACCTGATGATGTACCTCTGCC;
hYAP-Rev1: TATTCCGCATTGCCTGCCG; hYAP-Rev2: AGGGCTAACTCCTGCCGAA; hYAP-Rev3: CTGGTGGGGGCTGTGACGTT;
hYAP-Rev4: CTAACTCCTGTGGCCTCACCT; hYAP-Rev5: ATTGCCTGTGGCCTCACCT; hYAP-Rev6: CCACTGTTAAGGAAAGGATCTG.
hTAZ-Fw: ATCCCAGCCAAATCTCGTG; hTAZ-Rev: TTCTGCTGGCTCAGGGTACT; hCTGF-Fw: CCTGCAGGCTAGAGAAGCA;
hCTGF-Rev: GATGCACTTTTTGCCCTTCT; hCYR61-Fw: AAGAAACCCGGATTTGTGAG; hCYR61-Rev: GCTGCATTTCTTGCCCTTT;
hGAPDH-Fw: AACAGCGACACCCACTCCTC; hGAPDH-Rev: CATACCAGGAAATGAGCTTGACAA; mSox9-Fw: CAGCAAGACTCTGGGCAAG;
mSox9-Rev: TCCACGAAGGGTCTCTTCTC; mCol2a1-Fw: ACCCCCAGGTGCTAATGG; mCol2a1-Rev: AACACCTTTGGGACCATCTTT;
mCol10a1-Fw: GCATCTCCCAGCACCAGA; mCol10a1-Rev: CCATGAACCAGGGTCAAGAA; mId1-Fw: GAGTCTGAAGTCGGGACCAC;
mId1-Rev: GATCGTCGGCTGGAACAC; mId2-Fw: ACAGAACCAGGCGTCCAG; mId2-Rev: AGCTCAGAAGGGAATTCAGATG;
mId3-Fw: CATAGACTACATCCTCGACCTTCA; mId3-Rev: CACAAGTTCCGGAGTGAGC; mActb-Fw: CTAAGGCCAACCGTGAAAAG;
mActb-Rev: ACCAGAGGCATACAGGGACA. Total YAP was detected using primers hYAP-Fw4 and
hYAP-Rev6. Individual YAP transcript variants were detected using primers indicated
in Table 1.
Table 1. List of human YAP transcript variants with alternate names, primers used for detection
by quantitative RT-PCR, and expected amplicon size(s) of PCR products
Protein extraction and western blotting
For detection of YAP, pYAP and green fluorescent protein (GFP), cells were lysed in
50 mM Tris–HCl containing 1 mM ethylenediaminetetraacetic acid (EDTA), 1 mM ethylene
glycol tetraacetic acid (EGTA), 1% (v/v) Triton X-100, 2% (v/v) protease inhibitor
cocktail (Sigma-Aldrich, St Louis, MO, USA), 10 mM ?-glycerophosphate, 50 mM sodium
fluoride (NaF), and 0.5 mM sodium orthovanadate (Na3Vo). For detection of phosphorylated Smad (pSmad)1,5,8 and total Smad1, cells were
lysed in phosphate-buffered saline (PBS) containing 1 mM EDTA, 1% (v/v) Triton-X-100,
1% (v/v) nonidet P-40, 0.1% (w/v) sodium dodecyl sulphate (SDS), 0.5% (w/v) sodium
deoxycholate, 20 mM NaF, 5 mM Na3Vo, 1% (v/v) protease inhibitor cocktail (Sigma-Aldrich), and 0.4% (v/v) phosphatase
inhibitor cocktail 2 (Sigma-Aldrich). Equal protein amounts, as determined by bicinchoninic
acid (BCA) protein assay (Sigma-Aldrich), were electrophoresed under reducing conditions
on 12% polyacrylamide-SDS gels (Criterionâ„¢ XT precast gels; Bio-Rad, Hercules, CA,
USA) and transferred onto polyvinyl difluoride membranes by semi-dry transfer. Membranes
were incubated with the following primary antibodies overnight at 4°C: anti-YAP (Cell
Signaling Technology (Danvers, MA, USA) #4912), anti-phosphorylated YAP (pYAP) (Ser127)
(Cell Signaling Technology #4911), anti-GFP (Abcam (Cambridge, UK) #13970), anti-?-actin
(Cell Signaling Technology #4967), anti-pSmad1,5,8 (Cell Signaling Technology #9511),
or anti-Smad1 (RD Systems (Minneapolis, MN, USA) #AF2039). YAP, pYAP and GFP were
detected with horseradish peroxidase (HRP)-conjugated secondary antibodies followed
by incubation with SuperSignal West Dura chemiluminescence substrate (Thermo Fisher
Scientific, Waltham, MA, USA) on a Fluor-S MultiImager (Bio-Rad). pSmad1,5,8 and total
Smad1 were detected by incubation with IRDye800 and Alexa Fluor 680-conjugated secondary
antibodies, respectively, and analysis on a LI-COR Odyssey Infrared Imager (LI-COR
Biosciences, Lincoln, NE, USA). Quantification was performed using LI-COR Odyssey
Software v2.1.
Alcian blue staining
Deposition of highly sulphated glycosaminoglycans was detected by whole-mount staining
of micromasses with 0.5% of alcian blue 8 GS dye (Carl Roth, Karlsruhe, Germany) at
pH 0.2, as described previously 25]. For relative quantitation, glycosaminoglycans were extracted from stained micromasses
with 6 M guanidine HCl for 6 hours at room temperature, and absorbance was measured
at 630 nm on a BioTEKâ„¢ plate-reader with Gen5 v1.05.11 software (BioTEK, Winooski,
VT, USA). To normalise for DNA content, DNA was extracted from parallel micromasses
by overnight incubation at 55°C in 50 mM Tris (pH 8.0) containing 100 mM EDTA, 100
mM NaCl, and 1% SDS, followed by precipitation using isopropanol, resuspension in
10 mM Tris (pH 8.0) containing 0.1 mM EDTA, and quantification using a NanoDrop ND-1000
spectrophotometer (Labtech).
Cell proliferation
C3H10T1/2 cells, non-transduced or transduced with hYAP or empty vector retrovirus,
were plated at 5,000 cells/cm2 (sub-confluent) or 25,000 cells/cm2 (confluent), and left to adhere overnight. The next day, medium was removed, cells
were washed with PBS, and medium with or without 10% FBS was added to the cells. To
measure cell proliferation after 24 h, cells were incubated with 10 ?M EdU for 3.5
hrs, and EdU incorporation into replicating DNA was detected using a Click-iT EdU
detection kit (Invitrogen) and analysis on a BD LSRII flow cytometer (BD Biosciences,
Franklin Lakes, NJ, USA). The percentage of EdU-positive cells was quantified using
FlowJo v7.6.1 software (Tree Star, Ashland, OR, USA).
Immunohistochemistry
Animal experiments were approved by the UK Home Office and carried out in accordance
with UK Home Office guidelines. C57Bl/6 mouse embryos at embryonic day 13.5 (E13.5),
E14.5 and E16.0 were used for experiments. Embryos were fixed in 4% paraformaldehyde,
and hindlimbs were dissected, dehydrated, embedded in paraffin, and cut into 5-?m
thin sections using a microtome. Immunohistochemistry (IHC) using antibodies against
YAP (Novus Biologicals, Littleton, CO, USA #NB110-58358), pYAP (Cell Signaling Technology
#4911), or isotype control antibody, was performed as previously described 7]. Antigen retrieval was performed by boiling in a citrate-buffered antigen unmasking
solution at pH6 (Vector Laboratories, Burlingame, CA, USA) in a waterbath for 20 min
(YAP staining) or by incubation with 0.5 mg/ml porcine pepsin in 0.2 N HCl for 15
min at 37°C (pYAP staining). Sections were counterstained with haematoxylin. Tile
scans were obtained using a Zeiss Axioscan Z1 slide scanner (Carl Zeiss, Oberkochen,
Germany). Higher magnification images were obtained using an Axioskop 40 (Carl Zeiss)
microscope with ProgRes C14 camera.
Statistical analysis
Data was analysed using GraphPad Prism (GraphPad Software, San Diego, CA, USA). Gene
expression in human MSCs was analysed by unpaired t test. All other data was analysed by two-way analysis of variance (ANOVA) with Bonferroni
post hoc test.