healthmedicinet

Human tissues

Gastric cancer (GC) tissues were provided by the National Cancer Center Hospital after
obtaining written informed consent from each patient, which was approved by the National
Cancer Center Institutional Review Board (ID: No.17-030). Tissue specimens were immediately
frozen with liquid nitrogen after surgical extraction, and stored at ?80 °C until
use.

Microarray analysis

Total RNA was isolated by suspending the cells in ISOGEN lysis buffer (Nippon Gene,
Toyama, Japan) followed by precipitation with isopropanol. We performed expression
analyses using Human Expression Array U95A version 2 (Affymetrix, Santa Clara, CA)
according to the suppliers’ protocols . The expression value (average difference:
AD) of each gene was calculated using GeneChip Analysis Suite version 4.0 software
(Affymetrix). Hierarchical clustering of microarray data was performed using GeneSpring
(Agilent Technologies Ltd., Palo Alto, CA), Microsoft EXCEL, and Cluster TreeView
22], 23]. All microarray data have been deposited in a MIAME compliant database, GEO (accession
number; GSE47007). By Wilcoxon u-test (p??0.05) and by showing a 2-fold change, genes expressed specifically in diffuse-type
GC were selected 22].

Cell lines and primary culture of mouse mesothelial cells

Three gastric cancer cell lines, HSC-57, derived from intestinal-type GC, and HSC-59
and HSC-60, both derived from diffuse-type GC, were established and characterized
by one of the authors 24]. SNU16, derived from diffuse-type GC, was provided from the American Type Culture
Collection (ATCC), Two other cell lines with efficiency in producing PD mice, 60As6
and 60As6GFP (60As6 expressing green fluorescence protein), were established by the
authors from the diffuse-type GC derived HSC-60 cell line after several passages of
intraperitoneal transplantation to mice 25]. CC-2511, a fibroblast cell line, was purchased from Lonza, Japan (Tokyo, Japan).
All cell lines were maintained in Dulbecco’s Modified Eagle Medium. Mouse mesothelial
cells were harvested by injection of 10 mL of warmed 0.25 % Trypsin/EDTA solution
into the peritoneal cavity 26]. The cells were incubated for 3 days in RPMI-1640 supplemented with L-glutamine,
Phenol Red and HEPES (WAKO, Tokyo, Japan). Met-5A, a human mesothelial cell line,
was provided by ATCC and maintained in Medium 199 (Life Technologies, Tokyo, Japan)
supplemented with 3.3 nM EGF (Life Technologies), 400 nM hydrocortison (Sigma-Aldrich,
St. Louis, MO USA), 870 nM Insulin (Life Technologies) and 10 % FBS.

RT-PCR

Total RNAs from human normal organs were purchased from BioChain, Hayward, CA. Total
RNAs were extracted using an RNeasy Mini kit (QIAGEN, Tokyo, Japan). After generating
first-strand cDNA from total RNA using ThermoScript RT-PCR System (Life Technologies,
Tokyo Japan), PCR was performed with AccuPrimeâ„¢ Pfx DNA Polymerase (Life Technologies) under the following cycling conditions of either
35 (LTR transcripts) or 25 cycles (others): 95 °C for 1 min; 56 °C (?-actin) or 58 °C
(others) for 1 min; and 72 °C for 1 min. The following primer sets were used: for
cellular promoter transcript, 5?-CTTCCTGAGATTCAGAGGCC-3? and 5?-CCAGAATTTGAAACTCAGCC-3?;
for LTR promoter-derived transcripts, 5?-TTCAGTTGCTTCAGGCCATC-3? and 5?-CCAGAATTTGAAACTCAGCC-3?;
for the 3? side of GSDMB, 5?-ATTCTGGACTTCCTGGATGC-3? and 5?-ATGTATGAAATCCAGGCTGG-3?; for MYH11, 5?- CAGTGACGATGAGAAGTTCC-3? and 5?- CGCAGAAGAGGCCAGAGTAC; and for ?-actin, 5?-TCATCACCATTGGCAATGAG-3? and 5?-CACTGTGTTGGCGTACAGGT-3?.

Reporter Assay

A genomic fragment, from ?1080 to +1053 of GSDMB and containing the LTR promoter, was amplified by PCR using LA Taq Hot Start DNA
polymerase (Takara) in 35 cycles of 96 °C for 30 s and 68 °C for 2 min, using primer
sets: 5?-CTTCCTGAGATTCAGAGGCC-3? and 5?-CTCGAGTTCACTGTGTTAGCCAGG-3?, and inserted
into a pGL3 basic vector (Promega, Madison, WI). It was truncated using the restriction
sites: Nhe I and EcoR I to generate the ?1035 to +1053 fragment; KpnI and EcoR I for ?426 to +1053; Nhe I and Afl II for ?61 to +1053; Nhe I and Eco81 I for +129 to +1053; and Nhe I and Stu I for +496 to +1053. The +496 to +1053 reporter construct was further truncated with
restriction enzymes: Nhe I and Swa I for +757 to +1053; Nhe I and Pvu II for +860 to +1053; Nhe I and BstX I for +989 to +1053; Xho I and BstX I for +496 to +989; Xho I and Pvu II for +496 to +860; and Xho I and Swa I for +496 to +757. For further truncation of the +496 to +989 fragment, PCR was
performed with the fragment as a template using Ex Taq DNA polymerase (Takara) in
35 cycles of 95 °C for 1 min, 58 °C for 1 min, and 72 °C for 1 min, using the following
primer sets: for +562 to +989, 5?-GCTAGCTGTGGGATTTGTACACATCC-3? and 5?- AGATCTCGACTGGGATTACAGG-3?;
and for +649 to +989, 5?-GCTAGCTTTATTTCCACTGGAAACCG-3? and 5?-AGATCTCGACTGGGATTACAGG-3?.
After amplification, fragments were inserted into pGL4.12[luc2CP] vector (Promega). The ?1 kb upstream regions of CXCR4 and CXCR7 were prepared by genomic PCR using MightyAmp DNA polymerase (Takara) in 35 cycles
of 98 °C for 10 s, 62 °C for 15 s, and 68 °C for 2 min, using the following primer
sets: for CXCR4, 5?-GCTAGCGCGCCCACTGCAAACCTCAG-3? and 5?-CTTAAGTCACTTTGCTACCTGCTGC-3?; and for CXCR7, 5?-GCTAGCCGGAGGCCCCCGGAGAGCAG-3? and 5?-CTTAAGTTTGCAACAACTGTGAGC-3?. These fragments
were inserted into the pGL4.12[luc2CP] vector. One microgram of each construct and the Renilla luciferase control reporter
vector (pRL-SV40 vector, Promega) were co-transfected into 1?×?10⁵ cells using SuperFect Transfection Reagent (QIAGEN). The luciferase assay was performed
24 h after the reporter introduction, using a Dual-Luciferase Reporter Assay System
(Promega). The assay was carried out in triplicate.

GSDMB enhancer-HSVtk lentivirus vector

A pMFG-HSVtk vector was provided by RIKEN BRC through the National Bio-Resource Project
of the MEXT, Japan, by courtesy of Dr. Hirofumi Hamada, and an HSVtk cDNA was excised
from it as an Nco I-BamH I fragment. To construct the GSDMB enhancer-HSVtk lentivirus vector, first the +496 to +989 fragment (GSDMB enhancer) was inserted into pcDNA3.1 (+) (Life Technologies) between Nhe I and Hind III sites, and then HSVtk cDNA was inserted into the vector at a BamH I site in the forward (for sense-strand expression) or reverse (for antisense-strand
expression) direction. Next, GSDMB enhancer-HSVtk sense and GSDMB enhancer-HSVtk antisense fragments were excised from the plasmid vectors as Nhe I-Not I fragments and inserted into pLVSIN-CMV neo vectors between the Xba I and Not I sites. Finally, a CMV promoter was removed from the lentiviral constructs. To generate
viral particles containing the vectors, the constructs were introduced into Lenti-Xâ„¢
293 T Cells (Takara) using Lenti-X™ HTX Packaging System (Takara). After 72 h’-incubation,
the medium was collected and the viral titer (cfu/mL) was determined by transduction
into HT-1080 cells in the presence of polybrene (5 ?g/mL in culture medium, Sigma-Aldrich).
The particles were applied to Met-5A and 60As6 (1?×?10⁵ cells per dish, in triplicate) in vitro in the presence of polybrene (5 ?g /mL), and the cells were incubated in medium containing
Gancicrovir (GCV, 5 ?g/mL, WAKO) for 5 days for cell growth assays. The assays were
performed in triplicate and P-value of Student’s t-test between the cultured cells with (+) and without (?) GCV was calculated.

Treatment of PD mouse model with GSDMB enhancer-HSVtk vectors

We previously reported a mouse PD model (PD mice) that was produced by intraperitoneal
injection of 60As6 cells 25]. 60As6GFP cells (1?×?10⁶ cells per mouse) were injected into the peritoneal cavity of 18 mice (6 week-old
mice of CB17/Icr-Prkdc??scid/CrlCrlj Genotype: scid/scid, Charles River, Yokohama
Japan) at day 1. The mice were divided into two groups; one group was injected with
the antisense expression vector, and the other group was injected with the sense vector;
both groups then were intraperitoneally injected with 2 mL of PBS solution containing
viral particle (5?×?10⁵ cfu) and Ganciclovir (2 mg) at 8, 10 and 12 day. The mean survival time of each group
and the P-value of Student’s t-test between the two groups were calculated. The study was approved by the National
Cancer Center Committee on Animal Experiments.