healthmedicinet

Primer design for LAMP detection of G119S ace–1 ^R
mutation in mosquitoes

Allele-specific LAMP (AS-LAMP) primers were designed based on published sequences
of the acetylcholinesterase gene carrying the ace–1 ^R
mutation 10]. To detect the mutant and wild type of ace–1 ^R
, the specific forward inner primer (FIP) and backward inner primer (BIP) were constructed
with the mutation on the 5? end. An additional mismatched nucleotide was added at
the penultimate position of each specific BIP to increase the specificity of the primers
to each targeted nucleotide site (Fig. 1). For primer mismatch optimization, DNA fragments from An. gambiae mosquitoes carrying either sensitive or resistance-type ace–1 genes were used as the template DNA of the LAMP reaction. The outer primers (B3 and
F3) were identical for the two primer sets.

Fig. 1. DNA sequence of the acetylcholinesterase gene surrounding the ace–1 ^R
mutation and position of the LAMP primers designed for this study. The mutation nucleotide
is bolded, G for the wild type (ace–1 ^S
) and A for the resistant type (ace–1 ^R
). Lower-case letters in BA8 and BA9 show additional mismatch

Mosquito collection

All mosquitoes used in this study were collected during the rainy season of 2008 in
the village of Soumousso (N 11°00, W 04°03) located in the Sudan Savannah zone, 380 km
from Ouagadougou and 38 km from Bobo-Dioulasso. The village is located within the
cotton belt, where insecticide pressure is higher than in other parts of the country,
as is the frequency of ace–1 ^R4]. Mosquitoes were collected as larvae and reared to adults for morphological classification
of species and sex. Only the female An. gambiae complex mosquitoes were used for analysis. The mosquitoes were kept in silica gel
containing tubes until used.

Extraction of DNA from field-collected mosquitoes

The genomic DNA of field-collected mosquitoes was extracted by homogenizing individual
mosquitoes with a pellet pestle in 100 µl Buffer A [0.1 M Tris HCl (pH 9.0), 0.1 M
EDTA, 1 % SDS, and 0.5 % diethyl pyrocarbonate] and incubating the homogenate for
30 min at 70 °C. After incubation, 22.4 µl of 5 M potassium acetate was added, and
the mixture was cooled on ice for 30 min. After centrifugation at 15,000 rpm for 15 min
at 4 °C, the DNA-containing supernatant was transferred into a new tube and mixed
with 45 µl isopropanol. The solution was centrifuged at 15,000 rpm for 20 min at 4 °C,
and the supernatant was discarded. The DNA pellet was rinsed with 70 % ethanol and
dried. The pellet was then diluted in 30 µl TE buffer.

LAMP reaction procedure

The LAMP reaction was carried out following manufacturer recommendations (Eiken Chemicals,
Tokyo, Japan). A master mix was prepared using 6.25 µl of 2× reaction mix (2.8 mM
each of dNTP, 40 mM Tris–HCl (pH 8.8), 20 mM KCl, 16 mM MgSO
₄
, 20 mM (NH
₄
)
₂
SO
₄
, 0.2 % Tween 20, and 1.6 M betain), 2.75 µl of distilled water and 0.5 µl of each
of the primers and the Bst DNA polymerase. The concentration of the primers used was 40 pmol/µl for the inner
primers (BIP and FIP) and 5 pmol/µl for the outer primers (B3 and F3). A volume of
11.5 µl of the master mix was placed into test tubes (including a negative control).
One µl of DNA solution was added to the sample tubes and 1 µl of distilled water to
the negative control tube. All procedures were carried out on ice. The tubes were
then incubated in a water bath or LA-200 real-time turbidimeter (Eiken Chemicals)
at 63 °C, and turbidity was measured. The reaction was terminated by heating the tube
at 95 °C for 5 min. A 2 % agarose gel electrophoresis at 100 V of the LAMP products
was performed and the gel was stained with ethidium bromide for examination under
UV light to check amplification bands.

PCR-RFLP for ace–1 ^R
mutation detection

The MR4 protocol 25] (based on Weil et al. 10]) was used for ace–1 ^R
mutation detection method by PCR-RFLP analysis. The ace–1 ^R
SNP region was amplified with two primers (MOUSTDIR1:) (25 pmol/?l) [CCGGGNGCSACYATGTGGAA]
MOUSTREV1 (25 pmol/?l) [ACGATMACGTTCTCYTCCGA]. PCR was carried out in a 25-µl tube
using KOD FX Neo DNA polymerase (Toyobo, Osaka, Japan). Amplification was performed
with 1 µl of genomic DNA as the template using the following PCR programme: 94 °C/2 min × 1
cycle, (98 °C/10 s, 68 °C/30 s) × 35 cycles, 68 °C/2 min × 1 cycle, and 4 °C hold.
The PCR product was digested by adding 1 ?l AluI (New England Biolabs, Ipswich, MA,
USA) restriction enzyme, 2 ?l of H
₂
0, and 2 ?l of buffer to 15 ?l. An incubation at 37 °C for 8–24 h 25] was observed. Finally, 5 µl of the digestion product was run on 2 % agarose gel and
stained in ethidium bromide.

Real-time PCR (RT-PCR) detection of the ace–1 ^R
mutation

RT-PCR detection of ace–1 ^R
was carried out based on the methods in the Anopheles Research protocol 25], 26], with the primers (forward: GCCGTCATGCTGTGGATCTT, reverse: GCCCGGTGGTCGTACAC) and
probes (wild type allele: VIC-CGGCGGCTTCTAC, mutant type allele: FAM-CGGCAGCTTCTAC)
with TaqMan GTXpress master mix (Life Technologies, Carlsbad, CA, USA) and analysed
by StepOne RT-PCR machine (Life Technologies). For the positive controls, DNA fragments
from An. gambiae mosquitoes carrying either sensitive or resistance-type ace–1 genes cloned into pBSSK vectors were used. PCR alignment scores were taken from respective
endpoint scatter plots.

Sequencing of mosquito DNA

DNA from An. gambiae mosquitoes was used as PCR templates. The target sequence was amplified using the
PCR primers BA3 (GCTGGTGGTCAACACGGATA) and BA4 (CCCAGCTGACTCCCAAGAAG), designed to
amplify a 603-bp DNA fragment of ace–1 including its SNP region. PCR was performed in a tube with KOD FX Neo DNA polymerase
(0.5 µl). The PCR programme was 94 °C/2 min × 1 cycle, (98 °C/10 s, 68 °C/30 s) × 35
cycles, 68 °C/2 min × 1 cycle, and 4 °C hold. The PCR product was purified using a
geneclean kit (MP Biomedicals, Santa Ana, CA, USA) and the final product was diluted
in 10 µl of distilled water. The nucleotide sequences were determined with a BigDye
terminator sequencing kit v. 3.1 (Life Technologies, Carlsbad, CA, USA) using an automated
3100 genetic analyzer (Life Technologies).

Statistical analysis

Sensitivity was defined as the ratio of true positives to combined true and false
positives, and specificity as the ratio of true negatives to combined true negatives
and false negatives. Calculation of specificity and sensitivity confidence limits
of AS-LAMP and RT-PCR was carried out using the Wilson score method 27].