healthmedicinet

Survey context and design

According to Haiti’s 2011 health facility census, its health care system includes
approximately 800 health facilities distributed among 10 departments 11]. About half of these facilities are dispensaires (outpatient clinics typically staffed by those with a nursing degree equivalent),
and about one quarter are centres sans lits (outpatient clinics often with limited beds for short observation and staffed by
at least one physician). The remainder are centres avec lits (facilities with inpatient services and one or more physician) or hospitals (facilities
with inpatient wards, and specialized services and staff). All types of facilities
offer outpatient services. While most hospitals have laboratories on-site, laboratory
capacity varies among other types of health facilities.

Study design

This nationally representative, cross-sectional survey of febrile outpatients used
a stratified cluster-sampling design where the primary sampling units, or clusters,
were facilities in each department (or stratum). From each stratum, a sample of health
facilities was randomly selected in proportion to the number of total facilities in
each department. The sampling frame of health facilities for this evaluation included
833 functional facilities with outpatient services, identified in the MSPP national
health facility census report of 2011 11]. All eligible febrile patients presenting for outpatient consultations at the sampled
health facility during regular working hours on the survey day were eligible for enrolment.
Reliable patient volume data was not available when the survey was planned; therefore,
facilities were not selected in proportion to their utilization.

Enrolment

Criteria for patient enrolment in the study were: (1) experiencing fever, defined
as a measured temperature ?37.5 °C, or history of fever at any time during the previous
2 weeks, (2) being aged 18 years or older, or having a guardian present who was 18 years
or older, and (3) providing informed consent. Patients were excluded from participation
if they had signs of severe disease, specifically: impaired consciousness, prostration,
intractable vomiting, convulsions, respiratory distress, shock, jaundice, or spontaneous
bleeding 12].

Sample size

A sample size of 533 enrolled subjects was calculated to detect a malaria prevalence
of 50 % with a precision of ±5 %, taking into account a type 1 error of 0.05, a design
effect of 1.25, and a non-participation rate of 10 %. The malaria prevalence estimate
was chosen to provide the most conservative estimate of sample size, and was informed
by a post-earthquake survey which demonstrated a malaria prevalence of 20.3 % among
febrile patients 6], much higher than had been observed in previous health facility surveys 3]–5] which raised uncertainty about the true burden of malaria in this population. Thirty
facilities were sampled across the 10 departments in Haiti (Fig. 2) to ensure an appropriate minimum number of units to account for clustering at the
facility-level.

Fig. 2. Map of sampled health facilities in Haiti

Survey procedures

The field work for the survey was conducted between December 7 and 14, 2012. Each
health facility visit was unannounced and took place over two consecutive days. On
the first day, the survey teams conducted a quantitative inventory of the facility’s
physical and human resources, and performed interviews with all available and consenting
health care providers in the outpatient department. For the facility inventory, the
survey teams utilized a standardized data collection instrument to assess resources
in outpatient clinics, laboratories, and pharmacies. A second day was dedicated to
an outpatient survey where patients presenting to the facility’s outpatient clinic
were screened for fever. Eligible, consenting, febrile patients were enrolled and
finger-prick blood samples were collected to prepare thick and thin blood smears from
each subject. These blood smears were reserved for later interpretation at the LNSP,
and were considered the gold standard. In addition, several drops of blood from each
participant were collected onto Whatman 903 protein saver cards for PCR to assess
sub-microscopic parasitaemia. Each patient was evaluated and treated per facility
standard of care by the provider and laboratory. After the clinical encounter, the
provider was asked to complete a short form on each study participant describing the
diagnosis, tests ordered, and treatments prescribed for febrile illness, including
anti-malarial drugs. Occasionally, if the provider was unable to fill out the form,
it was completed by the survey team based on the clinical note completed by the provider.
Enrolled patients were administered a post-consultation questionnaire to assess illness
history, mosquito net ownership, and malaria knowledge.

Laboratory procedures

Laboratory diagnosis of malaria was performed at two levels: (1) by the facility laboratory
using microscopy if operational, or by RDTs if available; and (2) by the LNSP reference
laboratory, which analysed survey-prepared blood smears from enrolled patients as
the “gold standard”. Facility laboratory results were documented by the survey team
if the laboratory completed and recorded the results by the end of the clinic day.
Gold-standard microscopy was performed according to a standard protocol 13]. Briefly, after fixation of the thin smear in methanol, thin and thick smears were
stained with 10 % Giemsa for 5–10 min. The survey-prepared blood slides, were double
read by two expert, microscopists at the reference laboratory who were blinded to
the facility laboratory results. The examination of slides began in January 2013,
approximately 1 month after preparation in the field. In order to declare a microscopy
specimen free of Plasmodium falciparum infection, 300–500 thick-smear fields were examined.

Dried blood spots, on Whatman 903 protein saver cards, were analysed in duplicate
by LNSP in June 2014 by polymerase chain reaction using photo-induced electron transfer
fluorogenic genus-specific primers (PET-PCR). Sample preparation, storage, extraction,
and assays were performed using protocols described previously 10], 14], but modified to account for World Health Organization (WHO) Evidence Review Group
recommendations made in March 2014 for PCR analysis in low transmission settings 15]. Briefly, the amplification of Plasmodium genus (5?–3?, forward primer: GCTCTTTCTTGATTTCTTGGATG; reverse primer: FAM-aggcgcatagcgcctgg
AGCAGGTTAAGATCTCGTTCG) was performed in a 30 µL reaction containing 2X TaqMan Environmental
buffer 2.0 (Applied BioSystems, Grand Island, NY, USA), 400 nm each of forward and
reverse primers. For each sample, duplicate PET-PCR reactions were run with 6 µL of
DNA template used in the PCR reaction with the following cycling parameters: initialization
at 95 °C for 15 min, followed by 45 cycles of denaturation at 95 °C for 15 s, annealing
at 63 °C for 60 s. The correct fluorescence channel was selected for FAM dye and the
cycle threshold (CT) values recorded at the end of annealing step. All assays were
performed using Applied Biosystems ABI 7500 or StepOne thermocyclers (Life Technologies,
Carlsbad, CA, USA). Cycle threshold values, which are continuous, semi-quantitative
measurements of parasite load, were obtained for all specimens. Those with CT values
of less than 40.0 were considered positive for malaria.

Positive samples were subjected to additional testing by nested 18S rRNA PCR (nPCR)
to confirm the Plasmodium species, utilizing a method previously described by Singh et al. 16]. Briefly, both primary and secondary PCR reactions were performed using 2 µL of DNA
template in 25 µL total volume containing 1X buffer, 2.5 mM MgCl
₂
, 200 µM dNTPs, 200 nM primers, and 1.25 units of Taq Polymerase (New England Biolabs,
Ipswich, MA, USA). The products were analysed for appropriate band size on a 2 % agarose
gel with a positive showing a single visible band.

Data management and analysis

Data were entered using Epi Infoâ„¢ 7 (7.1.1.14) (CDC, Atlanta, GA, USA) and Microsoft
Excel for Windows 7 (Microsoft, Redmond, WA, USA). Analysis was performed with SAS
9.3 (SAS Institute, Cary, NC, USA) and involved simple counts and percentages. National
estimates and 95 % confidence intervals (CI) were calculated using patient-level or
health facility-level weights as appropriate using the SAS PROC SURVEYFREQ procedure
in order to account for the complex sampling design. Sensitivity and specificity analyses
were conducted comparing facility diagnostic results to the survey-performed gold-standard
microscopy. The map was created using ARCGIS 10.2.2 (Esri, Redlands, CA, USA) using
spatial data of health facilities courtesy of the Haitian Institute of Statistics
and Informatics (Institut Haïtien de Statistiques et d’Informatiques) and National
Center of Geo-spatial Information Systems (Centre National de l’Information Géo-Spatiale).

Definitions

For the purposes of this survey, health facilities were defined as having the capacity
to diagnose malaria if they fulfilled the following criteria: (1) a facility laboratory
completed a malaria test on the survey day for at least one enrolled patient using
either an RDT or a microscopy examination of a blood smear, or (2) the survey inventory
results determined that there was on-site capacity to perform either microscopy (functional
microscope, reliable electricity, staining reagents, and a trained laboratory technician)
or RDTs (current stock of any one of the three MSPP-approved RDT brands and at least
one employee trained in performing RDTs). Reliable electricity was defined as having
electricity for four or more hours a day, 5 days a week or having at least one generator
in the hospital.

“Treatment according to guidelines” referred to directives set in the MSPP 2012 malaria
treatment policy and was defined as: (1) prescription of the correct dose of chloroquine
and primaquine to those with a positive malaria test result, and (2) no prescription
of anti-malarials to those with a negative test result 1]. For treatment doses, the total adult regimen is 1500 mg of chloroquine base (administered
over 3 days, with four tablets containing 150 mg each given on day one, and three
tablets given on days two and three) and a single dose of 0.75 mg/kg primaquine (maximum
adult dosage is 45 mg) on the first day of treatment. Paediatric regimens are adjusted
according to age and weight 1]. The MSPP/PNCM supplies tablets containing 150 mg of chloroquine base and 7.5 mg
tablets of primaquine.

Human subjects review

The survey protocol and questionnaire were reviewed and approved by the human subjects
review boards of the MSPP (reference number 1112-30) and the US Centers for Disease
Control and Prevention (Atlanta, GA, USA). Written consent was obtained from each
subject, or from guardians accompanying subjects younger than 18 years; children 7–17 years
old provided written assent to participate.