healthmedicinet

Cloning, protein expression and purification

PfCoronin: The full-length gene encoding 6×His-PfCoroninFL was codon optimized for expression
in Sf21 cells (GeneArt). The synthetic gene was cloned into the pFastBacHTB vector
using BamHI/XhoI restriction sites. Bacmid DNA was produced according to the Bac-to-Bac
manual (Invitrogen) using MultiBac cells. Bacmid DNA was transfected into Sf21 cells
using Cellfectin II (Invitrogen) according to the manufacturers instructions. Viral
stocks were amplified and used at a 1:1,000 dilution for protein expression. Following
addition of virus, Sf21 cells were incubated in suspension at 27°C and harvested by centrifugation after 72 h. Cells were re-suspended in lysis buffer
(50 mM Tris pH 8.0, 300 mM NaCl, 10 mM MgCl
₂
, 5 mM 2-mercaptoethanol, 0.5% Triton X-100) supplemented with cOmplete EDTA-free
protease inhibitors (Roche) and subjected to two rounds of freeze–thaw in liquid N
₂
. The lysate was incubated with 1 mg/mL DNAseI for 30 min rocking at 4°C, followed by centrifugation at 30,000g for 30 min. The soluble fraction was recovered, adjusted to 10 mM imidazole pH 8.0
and incubated with Profinity™ IMAC resin for 2 h at 4°C. The resin was washed sequentially with buffer 1 (50 mM Tris pH 8.0, 300 mM NaCl,
5 mM 2-mercaptoethanol, 20 mM Imidazole), buffer 2 (50 mM Tris pH 8.0, 1 M NaCl, 5 mM
2-mercaptoethanol) and buffer 1. Protein was eluted in elution buffer (50 mM Tris
pH 8.0, 300 mM NaCl, 5 mM 2-mercaptoethanol, 250 mM Imidazole) and analysed by SDS
PAGE. Fractions containing His-PfCoronin were pooled and cleaved overnight with TEV
protease during dialysis against buffer 3 (50 mM Tris pH 8.0, 300 mM NaCl, 5 mM 2-mercaptoethanol)
to remove the 6×His tag. The dialyzed protein was incubated with Profinity™ IMAC resin
for 2 h to bind un-cleaved protein. The cleaved protein was collected and the resin
washed with buffer 3 until no more protein came off as monitored by Bradford reagent
(BioRad). The cleaved sample and washes were pooled and concentrated to 0.5 mL. The
protein was subjected to size exclusion chromatography on a Superdex 200 10/300 GL
column (GE Healthcare) pre equilibrated in 30 mM Tris pH 8.0, 300 mM NaCl, 5 mM 2-mercaptoethanol.
Full length PfCoronin eluted at ~12 mL. The N-terminal breakdown product PfCoronin
1-388 (called herein PfCor-N), eluted at ~16 mL. Peak fractions were analysed by Coomassie-stained
SDS PAGE to assess protein purity. Fractions containing PfCor-N were pooled, concentrated
and stored at 4°C.

PfAldolase The gene for PfAldolase was amplified from P. falciparum genomic DNA using the primers PfAldoF 5?GATCGGATCCATGGCTCATTGCACTGAATATATG and PfAldoR
5?GATCCTCGAGTTAATAGACATATTTCTTTTC, and ligated into the pProEX-HTb vector (Invitrogen)
via BamHI/XhoI restriction sites, introducing an N-terminal 6×His tag. The plasmid
was transformed into BL21 (DE3) Escherichia coli cells and the protein expressed for 4 h at 37°C after addition of 1 mM IPTG. The cells were harvested, re-suspended in lysis buffer
(20 mM Tris pH 8.0, 300 mM NaCl, 0.3% Triton X-100, 5 mM 2-mercaptoethanol) supplemented
with cOmplete EDTA-free protease inhibitors. The suspension was sonicated and clarified
by centrifugation at 30,000g for 30 min at 4°C. The supernatant was collected, adjusted to 10 mM imidazole pH 8.0 and incubated
for 2 h at 4°C with Profinity ™ IMAC resin. The resin was washed sequentially with Wash Buffer
1 (50 mM Tris pH 8.0, 300 mM NaCl, 20 mM imidazole pH 8.0, 5 mM 2-mercaptoethanol),
Wash buffer 2 (50 mM Tris pH 8.0, 1 M NaCl, 5 mM 2-mercaptoethanol) and Wash Buffer
3 (50 mM Tris pH 8.0, 300 mM NaCl, 5 mM 2-mercaptoethanol). His-PfAldolase was eluted
with elution buffer (Wash Buffer 3 + 250 mM imidazole pH 8.0) and assessed for purity
and quantity by SDS PAGE. Elution fractions containing His-PfAldolase were pooled
and dialysed against Buffer A (50 mM MES pH 7.0, 100 mM NaCl, 2 mM DTT, 1 mM EDTA)
for 2 h, then subjected to cation exchange chromatography using HiTrap SPFF (GE Healthcare).
A gradient from buffer A to buffer B (50 mM MES pH 7.0, 1 M NaCl, 2 mM DTT, 1 mM EDTA)
was used to elute the protein. Peak fractions containing His-PfAldolase, as determined
by Coomassie-stained SDS PAGE, were pooled, concentrated and subjected to size exclusion
chromatography using a Superdex 200 10/300 gel filtration column (GE Healthcare) pre-equilibrated
in Buffer A. His-PfAldolase eluted off the column as a single peak at ~13 mL, corresponding
to a molecular weight of ~160 kDa which approximates the size of a tetramer. Peak
fractions were pooled, concentrated to 100 uM, aliquoted, flash frozen in liquid N
₂
and stored at ?80°C. Actin was purified from rabbit skeletal muscle acetone powder (Sigma-Aldrich) using
established protocols 33].

Sedimentation assays

High speed 2 ?M RSMA in CaBG was adjusted by the addition of 10× Mg-EGTA exchange buffer (ME)
(10 mM MgCl
₂
, 2 mM EGTA) to make Mg bound RSMA (Mg-ATP-Actin). Mg-ATP-Actin was polymerized by
the addition of 10× KMEI (0.5 M KCl, 0.1 M imidazole pH 7.0, 0.01 EGTA pH 8.0, 0.01 M
MgCl
₂
) and incubation for 2 h at room temperature. Proteins of interest [PfCor-N, PfAldolase
and alpha-Actinin (Cytoskeleton Inc.)] were added to the appropriate concentration
and the mixture incubated for a further 30 min at room temperature. The samples were
centrifuged at 60,000 rpm in a Beckman preparative ultracentrifuge for 1 h at room
temperature. The supernatant was carefully removed and adjusted with 5× RSB. The pellet
was rinsed with MgBG (2 mM Tris pH 8.0, 0.2 mM ATP, 0.5 mM DTT, 0.1 mM MgCl
₂
) and centrifuged at 60,000 rpm in a Beckman preparative ultracentrifuge for 1 h at
room temperature. The supernatant was carefully removed and discarded, and the pellet
re-suspended in 2× RSB to a volume equivalent to the first supernatant after addition
of RSB. The supernatant and pellet samples were boiled for 5 min and equal volumes
were separated by SDS PAGE, the gels stained with Coomassie brilliant blue (BioRad)
and the bands analysed by densitometry.

Low speed Low-speed sedimentation assays were performed as per high-speed sedimentation assays
with the following alterations. Mg-ATP-Actin was polymerized in the presence of the
proteins of interest for 2 h at room temperature. Samples were centrifuged at 13,000 rpm
in a standard benchtop centrifuge at 4°C. Supernatants were carefully collected and the pellet discarded. Supernatants were
adjusted with 5× RSB, boiled for 5 min and separated by SDS PAGE. The gels were stained
with Coomassie brilliant blue and the bands analysed by densitometry.

Kd determination Pre-polymerized Mg-ATP-Actin, prepared as per the high-speed sedimentation assay
protocol, was incubated with the protein of interest for 30 min then centrifuged at
60,000 rpm for 1 h at 22°C. The supernatants were collected, and adjusted with 5×
RSB. The pellets were rinsed with 1× KMEI and centrifuged as per the high-speed sedimentation
assay protocol. The pellets were re-suspended in 2× RSB to the equivalent volume of
the supernatant samples. Equal volumes were separated by SDS PAGE and the gels stained
with Coomassie brilliant blue. For assays involving proteins too close in size to
resolve by standard Coomassie staining, following SDS PAGE the proteins were subjected
to Western blot analysis. Band densities were analysed by densitometry and Kds determined according to the methods outlined in 34], 35].

Electron microscopy

Appropriate amounts of purified PfCor-N or PfAldolase were added to 2 ?M preformed
Mg-ATP-Actin filaments for 30 min at room temperature. The samples were adsorbed onto
Formvar-carbon films supported on 200-mesh copper grids. Grids were glow discharged
before sample application, then negatively stained with aqueous uranyl acetate (1%).
Samples were observed with an FEI Tecnai F30 microscope at 300 kV.

Fluorescence microscopy

Mg-ATP-Actin was polymerized by the addition of 2× TIRF buffer alone or in the presence
of proteins of interest and incubated in a covered tube at room temperature for 1 h.
The samples were incubated with 1 ?M Alexa Fluor
^®
488 Phalloidin (Life Technologies) for 5 min at room temperature. 3 ?L of the samples
were adsorbed onto coverslips coated with 0.05 ?g/?L poly-L-Lysine (Sigma-Aldrich). Fluorescence images were acquired using a Zeiss inverted
LSM-510 confocal microscope and processed using ICY image analysis software 36].

TIRF microscopy

Oregon Green (OG) labelled RSMA was prepared as previously described 37]. 1.5 ?M Mg-ATP-Actin (33% OG labeled) alone and in the presence of proteins of interest
(Pf-Cor or Fimbrin, a kind gift from Colleen T. Skau) was prepared for TIRF microscopy
by the addition of 2× TIRF buffer (10 mM imidazole pH 7.0, 50 mM KCl, 5 mM MgCl
₂
, 1 mM EGTA, 0.5 mM DTT, 0.2 mM ATP, 50 ?M CaCl2, 15 mM glucose, 20 ?g/mL catalase,
100 ?g/mL glucose oxidase, 0.5% methylcellulose 400 cP) to stimulate polymerization.
The samples were immediately loaded into a pre-made flow chamber and excited by evanescent
wave fluorescence on an IX-71 Olympus microscope fit with through the objective TIRF
illumination. Images were acquired every 15 s for 10–20 min by an iXon EMCCD camera
(Andor Technology) as previously described 38]. Movies were processed and analysed using ImageJ.

Plasmodium falciparum culture and maintenance

The 3D7 P. falciparum isolate was cultured as previously described 39]. Parasites were maintained in O
⁺
erythrocytes (Australian Red Cross Blood Bank, South Melbourne, Australia) at approximately
4% haematocrit, in a culture medium of RPMI-HEPES supplemented with 0.18% (w/v) NaHCO3
and 10% (v/v) pooled human serum from unexposed Melbourne blood donors or 0.5% (w/v)
AlbumaxII (Gibco). Cultures were incubated at 37°C under a 94% N
₂
, 1% O
₂
, 5% CO
₂
gas environment. Transfected lines were maintained in the presence of appropriate
drugs to select for the corresponding resistance marker included in the transfection
vectors.

Reverse transcriptase PCR (RT-PCR)

RT-PCR was performed as described 40]. Briefly, total RNA was extracted from synchronized 3D7 parasites at appropriate
time points post-invasion using TRIzol
^®
(Invitrogen), residual genomic DNA was removed using an RNAeasy
^®
column (Qiagen), and 5 ?g of total RNA was reverse transcribed with or without SuperScript
â„¢ II reverse transcriptase using random hexamers (Invitrogen), all according to the
manufacturers instructions. The following primers were used: Cor_RT_fwd (5?-CCTTTAATCAAGAATTTATA-TCC-3?)
and Cor_RT_rev (5?-CCTCATTCACATTCTCATCCTC-3?); ACT1_RT_fwd (5?-CCAAAGAATCCAGGAATTATGG-3?)
and ACT1_RT_rev (5?-GGAACAGTGTGTGATA-CACCATC-3?).

Vector construction and tagging

Endogenous tagging of PfCoronin (PF3D7_1251200) at the C-terminus was performed as
described using the pD3HA vector with parasite transfection following standard protocols
41].

Antisera and immunoprecipitation

Antisera was raised in rabbits against PfCor-N, expressed and purified from BL21 (DE3)
E. coli using standard methods. Immunoprecipitation was performed as previously described
40]. Briefly, 40–48 h 3D7 PfCoroninHA schizonts were subjected to protein extraction
using 1% TNET (1% Triton X-100, 50 mM Tris pH 7.4, 150 mM NaCl, 5 mM EDTA) supplemented
with cOmplete EDTA-free protease inhibitor cocktail (Roche). Pull downs were performed
using anti-PfCoronin or anti-HA coupled to protein G-Sepharose (Amersham Biosciences)
according to the manufacturers instructions. Proteins were separated by SDS PAGE and
subjected to western blot analysis. The blots were probed with rat anti-HA [1:1,000]
or rabbit anti-PfCoronin [1:1,000] and processed as previously described.

Immunofluorescence assays

Parasites were synchronized according to established methods to obtain late schizonts
or merozoites for re-invasion using either sorbitol or heparin treatment 42], 43]. Schizonts or invading parasites were fixed in a fixing solution of 4% paraformaldehyde
(ProSciTech)/0.0075% gluteraldehyde (ProSciTech) in phosphate buffered saline (PBS)
while rocking at room temperature for 30 min. Cells were permeabilized using 0.1%
Triton X-100 (BioRad) for 10 min at room temperature and blocked overnight using Blocking
Solution [3% (w/v) Bovine Serum Albumin (BSA) (Sigma-Aldrich) in PBS], while rocking
at 4°C. Cells were incubated with appropriate primary antibodies diluted in Blocking
Solution for 1 h at 4°C. Primary antibodies used were rat anti-HA [1:1,000] (Roche),
rabbit anti-PfGAP45 [1:500] 40], rabbit anti-Act 239-253 [1:300] 10], mouse anti-PfRON4 [1:500] 44]. Samples were washed twice in PBS and incubated for 1 h at 4°C with appropriate secondary
antibodies: Alexa Fluor
^®
488 or 594 goat anti-mouse, Alexa Fluor
^®
488 or 594 goat anti-rabbit and Alexa Fluor
^®
594 goat anti-rat (Invitrogen) [1:500] in Blocking Solution. Samples were washed three
times in PBS and cells were settled onto coverslips (type 1.5, Zeiss) coated with
1% polyethyleneimine (PEI) (Sigma-Aldrich). Cells were mounted with VectaShield
^®
(Vector Laboratories) with 0.1 ng/?L 4?,6-diamidino-2-phenylindole (DAPI) (Invitrogen).
Fluorescence images were acquired using Plan-Apochromat 100×/1.40 oil immersion Phase
contrast lens (Zeiss) on an AxioVert 200 M microscope (Zeiss) equipped with an AxioCam
Mrm camera (Zeiss). Deconvolution of image stacks was undertaken using Axiovision
release 4.7 or 4.8 software. Routine image manipulation was performed using FIJI and
Adobe Photoshop.

Solubility profile analysis

For solubility analysis of PfCoronin purified 3D7 P. falciparum merozoites were hypotonically lysed by re-suspending the merozoites in water supplemented
with complete EDTA-free protease inhibitor cocktail (Roche). The samples were snap
frozen in liquid N
₂
and incubated on ice for 10 min to thaw, releasing the cell contents. Water soluble
and insoluble proteins were separated by ultracentrifugation at 1,00,000g for 30 min at 4°C (TLA100.2 rotor, Beckman Optima TL Ultracentrifuge, Beckman Coulter).
Water insoluble fractions were further treated with Na
₂
CO
₃
pH 11.5 for 1 h at 4°C. Carbonate soluble and insoluble fractions were isolated by
ultracentrifugation as described. Samples were adjusted with 4 x reducing sample buffer
(RSB) and subject to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS
PAGE) followed by Western blot analysis.

Biosensor analysis

The amino analogue of PI(4,5)P2 (NH2-PI(4,5)P2 was synthesized with an ?-amino group
on the sn-1 position of a saturated lipid side chain as described previously 45]. NH2-PI(4,5)P2 was then conjugated with Sulfo-NHS-biotin (Thermo Scientific) to enable
immobilization onto the NeutrAvidin derivatized sensor surface according to a previously
described protocol 46]. Experiments were performed using a Biacore 3000 biosensor (Biacore Life Sciences,
GE Healthcare). Various concentrations of PfCor-N (2.6 ?M, 1.3 ?M, 650 nM, 325 nM,
162.5 nM and 81.2 nM) and PfADF1 (3.8 ?M, 1.9 ?M, 950 nM, 475 nM, 237.5 nM, and 188.8 nM)
were injected over PI(4.5)P2, immobilized onto a CM5 sensor surface derivatized with
NeutrAvidin using NHS/EDC chemistry (140RU immobilized) (Catimel 2013). A NeutrAvidin
channel was used as the control. The reactivity of immobilized PI(4,5)P2 was assessed
by injecting various concentrations of the GST-tagged Pleckstrin Homology domain of
Phospholipase C, gamma 1 (GST-PLC?-PH) (350, 175, 87.5, 43.8, 21.9 and 11 nM) 46].

Kinetic constants were derived from the resulting sensorgrams with BIAevaluation 4.1
software (Biacore Life Sciences, GE Healthcare) using Global analysis using a 1:1
Langmuir model that includes terms for mass transfer of analyte to the surface.