healthmedicinet

Genetic identification of lactobacilli isolates from koumiss

For isolation probiotic strains, home-made fermented koumiss were collected from Xilingol
pastoral areas of Inner Mongolia. The milk samples were enriched in de Man, Rogosa
and Sharpe (MRS) broth. Pour plating was also done with serial decimal dilutions and
the submerged colonies were selected for morphological examination using Gram staining.
The putative lactobacilli isolates were further subjected to catalase test and analysis
of 16S rRNA gene sequences. The genomic DNA from the cultures was extracted by using
DNA purification kit (TIANGEN, China). Genus specific PCR assays were carried out
using two universal primers, 27f and 1492r 35]. The sequence data was aligned and analyzed using BLAST server available at NCBI
website. Further confirmation of NS8 isolate was carried out by PCR using the L. helveticus specific primer pairs pepC/pepN/htrA 17] as well as primers targeted against slpH gene encoding S-layer protein (forward 5’GTTTAAGAATGGCAAGCG3’, reverse 5‘ACAAGAACAGCGACAAGC3’).
Meantime, L. acidophilus specific primers targeted against slpA (forward 5‘GCTGGCTTTACTTGCTGTTGC3’, reverse 5‘CTCTTGCTTACGCTGGCTAC3’) were also applied
into the PCR assay.

Acid and bile salt tolerance

The resistance of lactobacilli isolates to gastrointestinal tract environment was
tested as previously described 36]. Briefly, overnight cultures (10
⁷
–10
⁹
 CFU/mL) were harvested and washed twice with PBS buffer, before being resuspended
in MRS broth with pH 2 or pH 3 or enriched with 0.2 or 0.3 % (w/v) Ox-Bile (Bio Basic
Inc, China). After incubation at 37 °C for 2 h, acid tolerance was assessed in term
of viable colony counts by MRS agar plating. For test of tolerance to bile salt, the
cultures were inoculated for 4 h and colony counts were as well enumerated.

Adhesion to Caco-2 Cells

Adhesion to Caco-2 cells was assayed as the method described by Jacobsen 37]. Caco-2 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Hyclone, USA),
supplemented with 10 % (v/v) fetal bovine serum (Gibco, USA), 100 U/mL penicillin,
and 100 ?g/mL streptomycin at 37 °C in a humidified 5 % CO
₂
atmosphere. Approximately 5?×?10
⁵
Caco-2 cells were seeded in 6-well tissue culture plate and the medium was replaced
by fresh nonsupplemented DMEM, at least 1 h before the bacterial suspension (c. 1?×?10
⁸
 CFU/mL) was added to each well. After co-incubation for 2 h, nonadherent cells were
washed off by flushing with sterile PBS. Remaining adhered cells were detached by
trypsinization and platted on MRS agar by serial dilution. Adhesion ability was expressed
as the ratio between adherent bacteria and the initial number of added bacteria. Experiments
were carried out in triplicate.

Scanning electron microscopy

Scanning electron microscopy was also performed for qualitative examination of adhesion.
Briefly, Caco-2 cells with adherent bacteria were fixed with 2.5 % glutaraldehyde
for 24–72 h at 4 °C. The specimens were then dehydrated with a graded series of ethanol
solutions (25, 50, 75, 90, and two times 100 %, 10 min each step). Critical-point
drying and gold-coating were performed continuously, and specimens were then examined
with a scanning electron microscope (Hitachi, S-3000 N).

Cellular aggregation

Autoaggregation assays were performed by following the method of Del et al. 38]. The freshly grown bacterial cells were harvested and washed twice with PBS following
resuspending again in PBS to get an absorbance of ?0.5 at 600 nm (A₀
). During 5 h of incubation at room temperature, every hour 1 mL of the upper suspension
was taken to measure the absorbance at 600 nm (A_t
). The autoaggregation percentage can be expressed as: (1???A_t
/A₀
)?×?100.

Cell surface hydrophobicity

The bacterial surface hydrophobicity was determined according to the method of Rosenberg
et al. 39]. Bacterial cells in the stationary phase were resuspended in 0.1 M KNO
₃
(pH 6.2) to approximately 10
⁸
 CFU/mL and the absorbance was measured at 600 nm (A₀
). One millilitre of xylene, chloroform or ethylacetate was separately mixed with
3 mL of bacterial suspension by vortexing and incubated at room temperature for 10 min.
The mixture was again briefly vortexed and incubated at room temperature for 20 min
for phase separations. The aqueous phase was gently moved to measure its absorbance
at 600 nm (A₁
). The surface hydrophobicity (%) was calculated as (1???A₁
/A₀
)?×?100.

Extraction of S-layer proteins

Extraction of the S-layer protein from L. helveticus was performed as described previously 40]. Washed cells were incubated with 5 M LiCl in a shaking incubator (200 rpm) for 60 min
at 37 °C, followed by centrifugation at 10, 000 g, 4 °C for 10 min. The supernatant
was dialyzed against distilled water at 4 °C for 48 h using a cellulose membrane with
cut-off value of 10 kDa (Sigma). The extract was further concentrated by using Amicon
Ultra (Millipore, USA). Protein concentration was measured by BCA protein assay before
SDS-PAGE analysis.

Induction of colitis in vivo

BALB/c mice (female, 8 weeks) purchased from Vital River Laboratories (China) were
fed with regular rodent chow and tap water. After adaptation period, the mice were
randomly selected and assigned to 3 groups of 10 mice each. For colitis induction,
a standardized murine TNBS colitis model was used 25]. Briefly, anesthetized mice received an intrarectal administration of 40 ?l solution
of TNBS (100 mg/kg, Fluka) dissolved in 50 % ethanol. Control blank mice received
50 % ethanol. Bacterial suspensions (100 ?L), containing 1?×?10
⁹
 CFU/mL in PBS buffer were administered intragastrically to mice each day, starting
5 days before until 1 day after TNBS processing. The mice were weighed and killed
48 h after TNBS administration. Colons were removed, washed and opened. Macroscopic
lesions were evaluated according to the Wallace criteria 30]. Histological analysis was performed on hematoxylin/eosin-stained 5 ?m tissue sections
from colon samples fixed in 4 % paraformaldehyde and embedded in paraffin. The Animal
Care and Ethics Committee at Hangzhou Normal University approved all of the animal
experiments in our study.

Isolation of peripheral mononuclear cells (PBMCs)

For isolation the PBMCs from human peripheral blood, nine blood samples of healthy
donors were procured from Beijing Red Cross Blood Center. All the donors had written
informed consent before donation. PBMCs were isolated as previously described 41]. Briefly, after a Ficoll gradient centrifugation, the buffy coat enriched with mononuclear
cells was collected, washed in RPMI 1640 medium (Hyclone) and adjusted to 2?×?10
⁶
cells/mL in RPMI 1640 supplemented with gentamicin (150 ?g/mL), L-glutamine (2 mmol/L),
and 10 % FBS.

Cytokine induction and Elisa assay

PBMCs (1?×?10
⁶
cells/mL) were seeded in 24-well tissue culture plates. Approximately 1?×?10
⁸
 CFU/mL lactobacilli were added (bacteria: cell ratio of 100:1) to different wells.
After 24 h co-incubation, the culture medium was centrifuged at 12,000 g for 5 min
at 4 °C, and the supernatant was collected and stored at ?20 °C until cytokine measurement.
Production of TNF-?, IL-10 and IL-12p70 in supernatants was measured by ELISA kit
(BD Biosciences, USA) according to the manufacturer’s protocol.

Macrophage culture and treatment

Mouse macrophage cell line RAW264.7 was used for studying inflammatory response. RAW264.7
cells were maintained in DMEM supplemented with 10 % FBS, 100 U/mL penicillin, and
100 ?g/mL streptomycin at 37 °C. Approximately 5?×?10
⁵
cells were seeded into 6-well tissue culture plate and allowed to adhere for 2 h prior
to LPS activation. RAW264.7 cells were exposed to 1 ?g/mL lipopolysaccharide (LPS,
from E. coli serotype O127: B8, Sigma), followed by treated with lactobacilli (bacteria: cell
ratio of 100:1) or 10 ?g/mL S-layer protein purified from NS8 strain. The plates were
incubated for 4 h before cytokine measurements.

Real time PCR

Total RNA of RAW264.7 cells was extracted with TRIzol reagent (Invitrogen, USA). Reverse
transcription was performed with a cDNA Reverse Transcription Kit (TIANGEN, China)
according to the manufacturer’s instructions. Quantitative real-time PCR was carried
out using Applied Biosystems 7300 (Life Technologies, USA). The reaction mixture was
performed with SYBR® Premix Ex Taq™ (TaKaRa, China) according to the manufacturer’s protocols. The reaction conditions
were 40 cycles of two-stage PCR consisting of denaturation at 95 °C for 15 s and annealing
at 60 °C for 1 min after an initial denaturation step at 95 °C for 10 min The primer
sequences were as follows: mouse TNF-?, forward 5‘ggcggtgcctatgtctcag3’ and reverse
5‘ggctacaggcttgtcactcg 3’; mouse IL-10, forward 5‘acatactgctaaccgactcct3’ and reverse
5‘ggtcttcagcttctcaccc3’; mouse IL-12p40, forward 5‘atgtggaatggcgtctc3’ and reverse
5‘gtctcctcggcagttgg3’; and mouse ?-actin, forward 5‘agagggaaatcgtgcgtgac 3’ and reverse
5‘cgctcgttgccaatagtgat3’. For the relative comparison of mRNA expression levels, the
data were analyzed with a ??Ct method and normalized to the amount of ?-actin cDNA
as an endogenous control.

Statistical analysis

Data analysis was carried out with SPSS, Inc. software (version 10.0). Differences
between two groups were assessed using the unpaired two-tailed Student’s t-test. Data sets that involved more than two groups were assessed using One-way ANOVA.
Differences were considered significant if P was 0.05.