healthmedicinet

Tissue processing

Tissue samples from tumors were collected during surgery and stored at ?80 °C. Tissue
samples were micro-dissected in order to remove areas of necrosis, cellular debris
and any non-neoplastic tissue prior to protein, DNA and RNA extraction. The tumor
area of interest was concomitantly collected for pathological diagnosis and grade
stratification according to the latest WHO classification of CNS tumors by two independent
pathologists. The tumors were graded as AST II astrocytoma grade II (AST II), glioblastomas
(GBM) and oligodendrogliomas grade II (OLI II) and oligodendrogliomas grade III (OLI
III). GBMs were divided in two subgroups based on patients’ overall survival time
after diagnosis as GBM of short survival (GBM-SS, 6?±?4 months, ?=?4) and long survival (GBM-LS, 43?±?15 months, ?=?4). Non-neoplastic brain tissues (NN, mean age at surgery, 29?±?7 years, ?=?4) were obtained from individuals submitted to temporal lobe resection for epilepsy
surgery and examined by a pathologist who confirmed the abundance of astrocytic cells
in the resected tissue. Four samples for each group were pooled and analysed by the
proteomic approach (ASTII mean age at diagnosis, 33?±?7 years; GBM-SS 48?±?23 years;
GBM-LS 48?±?18 years; OLI II 42?±?16 years and OLI III 48?±?15 years). An independent
casuistry comprised of 22 (NN), 23 (AST I), 26 (AST II), 18 (AST III), 83 (AST IV
or GBM), 25 (OLI II), and 26 (OLI III) was analyzed at the validation step by qRT-PCR
for the selected targets. All samples were collected during surgical procedures by
the Neurosurgery Group of the Department of Neurology at the Hospital das Clinicas
of School of Medicine of São Paulo, University of Sao Paulo, Brazil from 2000 to 2008
and the follow-up of cases are being carried out to date. This study was approved
by the Brazilian National Bioethics Commission (CONEP), and by the Ethics Committee
of the Medical School of Ribeirao Preto and School of Medicine of São Paulo of the
University of Sao Paulo. Written consent was obtained from each patient authorizing
the use of their tissues in the present investigation.

Tumor protein extraction

Tissue samples were mechanically homogenized in lysis buffer containing 30 mM Tris-HCl
pH 7.5, 150 mM NaCl, 1 % Triton X-100, 10 % glycerol and a protease inhibitor cocktail.
The cell lysates were centrifuged at 20,000 g for 30 min, the supernatants were precipitated
with 20 % trichloroacetic acid and washed three times with cold acetone. Electrophoresis
buffer (200 µL) containing 10 mM Tris base, pH 9.0, 7 M urea, 2 M thiourea, 65 mM
DTT and 4 % CHAPS was added to each pellet. Proteins pellets were then submitted to
three cycles of 5 min each in an ultrasound bath (UltraSonic Clear 750, UNIQUE) centrifuged
and supernatant were kept for protein concentration determination.

Sample preparation and iTRAQ labeling

Each protein extract of tumor and non-neoplastic tissue were quantified by the method
of Bradford 19]. Twenty five ?g of each patient sample was pooled to normalize 100 ?g total protein
for each category. Additional file 1: Figure S1 describes a schematic experimental approach. Pooled samples were mixed
with 6× volume of cold acetone (?20 °C) and incubated for 60 min at ?20 °C. The proteins
pellets were reconstituted according to manufacturer’s protocol (Applied Biosystems,
Framingham, MA, USA). Briefly, proteins pellets were re-suspended into 20 ?L of dissolution
buffer (0.5 M triethylammonium bicarbonate), 1 ?L denaturant (2 % SDS), and 2 ?L reducing
reagent (50 mM tris-(2-carboxyethyl) phosphine). Free cysteine was blocked by adding
1 ?L of 200 mM methyl methanethiosulfonate in isopropropanol. Sequencing grade modified
trypsin was from Promega (Madison, WI) and was reconstituted with deionized water
at 1 ?g/?L concentration. In each vial 10 ?L of trypsin solution was added and incubated
overnight (18 h) at 37 °C. Reagents of 8plex iTRAQ were allowed to reach room temperature
and then reconstituted with 50 ?L of isopropanol. Each label reagent was mixed with
the corresponding protein digest and incubated at room temperature for 2 h. Samples
were pooled into a new vial and dried in SpeedVac (Savant Inc, New York, NY). After
reconstituted with 0.1 % formic acid (FA), the digest was desalted on a Waters Oasis
HLB column and eluted with 60 % acetonitrile (ACN)/ 0.1 % FA. Eluted peptide mixture
was dried.

Strong cation exchange fractionation (SCX)

The sample was reconstituted with 100 ?L SCX buffer A (10 mM KH
₂
PO
₄
, 20 % ACN, pH2.7) and separated on a PolyLC Poly-sulfoethyl-A column (200×2.1 mm,
5 ?m, 200 Å) with a linear 200 ?L/min gradient of 0-70 % buffer B (10 mM KH
₂
PO
₄
, 20 % ACN, 500 mM KCl, pH2.7) in 45 min on an Agilent 1200 LC device with Chemstation
B.02.01 control software. Fractions were collected each minute and eventually pooled
into 20 fractions. The fractions were desalted, eluted, and dried as described above
using Waters Oasis HLB column.

Mass spectrometry

The samples were reconstituted with 0.1 % formic acid. Liquid chromatography was performed
on an Eksigent nanoLC-Ultra 1D plus system (Dublin, CA). Peptide digest was first
loaded on a Zorbax 300SB-C18 trap (Agilent, Palo Alto, CA) at 6 ?L/min for 5 min,
then separated on a PicoFrit analytical column (100 mm long, ID 75 ?m, tip ID 10 ?m,
packed with BetaBasic 5 ?m 300 Å particles, New Objective, Woburn, MA) using a 40-min
linear gradient of 5-35 % ACN in 0.1 % FA at a flow rate of 250 nL/min. Mass analysis
was carried out on an LTQ Orbitrap Velos (Thermo Fisher Scientific, San Jose, CA)
with data-dependent analysis mode, where MS1 scanned full MS mass range from m/z 300
to 2000 at 30,000 mass resolution and six HCD MS2 scans were sequentially carried
out at resolution of 7500 with 45 % collision energy, both in the Orbitrap.

Database search and quantitative data analysis

MS/MS spectra from 20 fractions were searched against the Swiss Prot (Swiss Institute
of Bioinformatics) database, taxonomy Homo sapiens (human) using Mascot software (Matrix
Science, London, UK; version 2.3), with precursor mass tolerance at 20 ppm, fragment
ion mass tolerance at 0.05 Da, trypsin enzyme with 2 miscleavages, methyl methanethiosulfonate
of cysteine and iTRAQ 8plex of lysine and the n-terminus as fixed modifications, and
deamidation of asparagine and glutamine, oxidation of methionine and iTRAQ 8plex of
tyrosine as variable modifications. The resulting data file was loaded into Scaffold
Q+ (version Scaffold 4.3.0, Proteome Software Inc., Portland, OR) to filter and quantitate
peptides and proteins. Peptide identifications were accepted at 80.0 % or higher probability
as specified by the Peptide Prophet algorithm 20] and a false discovery rate (FDR) of less than 1 %. Protein identifications were accepted
at 95.0 % or higher probability and contained at least 2 identified peptides with
FDR less than 1 %. Protein probabilities were assigned by the Protein Prophet algorithm
21]. Proteins that contained similar peptides and could not be differentiated based on
MS/MS analysis alone were grouped to satisfy the principles of parsimony. Peptides
were quantified as the centroid reporter ion peak intensity, with minimum of 5 % of
the highest peak in the spectrum. Intra-sample channels were normalized based on the
median ratio for each channel across all proteins. Isobaric tag sample was normalized
by comparing the median protein ratios for the reference channel. Quantitative protein
values were derived from only uniquely assigned peptides. Protein quantitative ratios
were calculated as the median of all peptide ratios. Standard deviations were calculated
as the interquartile range around the median. Quantitative ratios were log
₂
normalized for final quantitative testing.

Western blot

The samples were diluted in NuPAGE SDS Sample buffer (Invitrogen NP0007) and the SDS-PAGE
was performed using NuPAGE Novex Bis-Tris Mini Gels 4–12 %. SDS-PAGE gels were electrobloted
in iBlot Device and the membranes were incubated with primary antibodies HSPB1/HSP27
and HSP90B1(GRP94) from Cell Signaling Technology; NPM and RKIP from Zymed-Invitrogen;
NCL and ?-actin from Santa Cruz Biotechnology; NOVA-1 from Sigma-Aldrich. The same
source of antibodies HSPB1 and NOVA1 were used for immunohistochemistry.

RNA extraction and cDNA synthesis

Total RNA was extracted from each tissue using the RNeasy Mini Kit (Qiagen, Hilden,
Germany). RNA quantification and purification was determined by measuring absorbance
at 260 and 280 nm. A260/A280 ratios in the 1.8–2.0 range were considered to indicate
a satisfactory level of purity. Denaturing agarose gel electrophoresis was used to
assess the quality of the samples. cDNA synthesis was performed by reverse transcription
of 1 ?g total RNA previously treated with one unit of DNase I (FPLC-pure, GE Healthcare,
Piscataway, NJ,) using random and oligo(dT) primers, RNase inhibitor, and SuperScript
III (Life Technologies) according to the manufacturer’s recommendations.

Quantitative real-time PCR (qRT-PCR)

For qRT-PCR, quantitative data were normalized relative to the internal housekeeping
control genes hypoxanthine phosphoribosyltransferase 1 (HPRT), beta-glucuronidase (GUSB), and TATA-box binding protein (TBP) 22]. The geometric mean of the housekeeping genes was used for the analysis of relative
expression of tissue samples. Primer sequences were as follows (5?– 3?): HSPB1 F: GGACGAGCTGACGGTCAAGA, HSPB1 R: CGGGAGATGTAGCCATGCT, NOVA1 F: GGAGCCACCATCAAGCTGTCTA, NOVA1 R: TCAGTGCTTCAACCGTTCCCT, HPRT F: TGAGGATTTGGAAAGGGTGT, HPRT R: GAGCACACAGAGGGCTACAA, GUSB F: AAAATACGTGGTTGGAGAGCTCATT, GUSB R: CCGAGTGAAGATCCCCTTTTTA, TBP F: AGGATAAGAGAGCCACGAACCA, and TBP R: CTTGCTGCCAGTCTGGACTGT synthesized by IDT. Sybr Green I amplification mixtures
(12 ?L) contained 3 ?L cDNA, 6 ?L 2 × Power Sybr Green I Master Mix (Applied Biosystems,
Foster City, CA), and forward and reverse primers at final concentrations of 200–400
nM. Reactions were run on an ABI 7500 Real-Time PCR System (Applied Biosystems). The
cycling conditions were: incubation at 50 °C for 2 min to activate UNG, initial denaturation
at 95 °C for 10 min, and 40 cycles of 15 s each at 95 °C and at 60 °C for 1 min. DNA
melting curve analysis showed a single peak for all genes. The 2
^???CT
equation was applied to calculate the relative expression 23]. For the relative expression analysis of GBM cases, the mean of control non-neoplastic
brain samples was used as calibrator.

Immunohistochemistry

For immunohistochemical detection of HSPB1 and NOVA1, tissue sections were routinely
processed and subjected to antigen retrieval. Briefly, slides were immersed in 10 mM
citrate buffer, pH 6.0 and incubated at 122 °C for 3 min using an electric pressure
cooker (BioCare Medical Walnut Creek, CA). Specimens were then blocked and further
incubated with a mouse monoclonal antibody raised against human HSPB1 and NOVA1 at
a final dilution of 1:100 at 16-20 °C for 16 h. The reaction was developed using a
Novolink commercial kit (Novocastra, New Castle, UK) at room temperature using diaminobenzidine,
and Harris hematoxylin for nuclear staining. All prepared slides were independently
analyzed by two observers, and the positive reaction was quantitated for HSPB1 and
NOVA1 as the percentage of positive cytoplasm/nuclei cells: zero (0), when no positivity
was detected; 1, when up to 25 % of positive cells were present; 2, for 26-50 % of
positive cells; 3, for 51-75 % of positive cells, and 4, for over 76 % of positive
cells.

Statistical analysis

The statistical analysis of HSBP1 and NOVA1 expression by qRT-PCR in astrocytomas,
oligodendrogliomas and non-neoplastic tissues was performed by Kruskal-Wallis and
Mann-Whitney tests as well as the proteomic profiling through statistical package
included in Scaffold v.4.3.0 software, blocked t-test and ANOVA for categories (p-value, ASTRO, OLI or ASTRO/OLI) (Proteome Software,
Inc, Portland, Oregon). Discrimination of variables was calculated by the receiver
operator characteristic (ROC) curve utilizing area under curve and asymptotic significance.
The continuous variables were categorized through a curve using ROC the value with
the best sensitivity and specificity. Differences in gene and protein expressions
were considered to be statistically significant at p??0.05.