An active alternative splicing isoform of human mitochondrial 8-oxoguanine DNA glycosylase (OGG1)

According to the National Center for Biotechnology Information (NCBI), the human 8-oxoguanine
DNA glycosylase (OGG1) gene encodes the enzyme responsible for the excision of 8-oxoguanine
(8-oxoG), a mutagenic base byproduct that occurs as a result of exposure to reactive
oxygen (http://www.ncbi.nlm.nih.gov/gene/4968). 8-oxoG was first described in 1984 by Kasai et al. 1] and is an abundant DNA adduct caused by oxidative stress 2]. The action of OGG1 includes lyase activity for chain cleavage. In 1997 Aburatani
et al. described four isoforms (OGG1-1a, ?1b, ?1c and ?2) 3], and then in 1999, Nishioka et al. described seven isoforms (?1a, ?1b, ?2a, ?2b,
?2c, ?2d and ?2e) 4]. They classified these isoforms into two groups based on their last exon: type 1
isoforms end with exon 7 and type 2 isoforms end with exon 8. At present, their type
1 nomenclature cannot be applied to OGG1-1b because it contains only exons 1–6 (NCBI: NM_016819). Now, type 1 and type 2 OGG1s can be grouped with or without exon 8. Eight alternatively spliced isoforms of OGG1 (OGG1-1a, ?1b, ?1c, ?2a, ?2b, ?2c, ?2d and ?2e) are registered in the NCBI gene and nucleotide
database. OGG1-1a is the only OGG1 present in the nucleus 4], whereas the other seven isoforms have been shown to be present in mitochondria 3]–5]. Recombinant OGG1-1a has been purified and its enzyme kinetics determined 6]–8]. Although mitochondrial OGG1 was suggested to have a crucial role against mitochondrial
DNA damage 9], the responsible OGG1 splicing isoform(s) have not been described in detail. Recombinant
production of the mitochondrial major OGG1 isoform, OGG1-2a (also named ?-OGG1), has
been carried out; however, the activity of this OGG1 was very low 9] or un-detectable 10]. Recently, we purified recombinant mitochondrial OGG1-1b and showed that it was an
active OGG1 enzyme; we determined its enzyme kinetics, and compared these results
with those of OGG1-1a 11]. Similar 8-oxoG glycosylase activity and N-glycosylase/DNA lyase activity was detected except for k_gl
(N-glycosylase/DNA lyase activity) against 8-oxoG:A. Currently, the other five mitochondrial
OGG1 isoforms have not been purified.

A review of all eight alternatively spliced isoforms has not been published; therefore,
in this review I present the published data on mainly mitochondrial OGG1 isoforms
and summarize the information on eight alternative splicing isoforms archived by the
NCBI.

OGG1-1b

Human OGG1-1b was cloned as an alternatively spliced isoform of OGG1 by Abratani et al. in 1997 3] and confirmed by Nishioka et al. 4]. They proposed that the OGG1-1b mRNA contained an extra 244 bp from intron 6 and the same exon 7 compared with
the OGG1-1a mRNA. However, OGG1-1b mRNA is currently described in NCBI (NM_016819) as composed of 6 exons (exons 1–6)
and does not possess exons 7 and 8. Localization of the OGG1-1b protein in mitochondria
was published by Takao et al. 5]. They showed localization of a FLAG-tagged OGG1-1b in the mitochondria of COS-7 cells
by immunofluorescence staining. The expression of OGG1-1b was demonstrated by RT-PCR in several human tissues, including lung 11], 12], colon 3], cerebrum 4], kidney 4], fetal brain 4], peripheral blood lymphocytes 13], and in human cell lines including normal-derived lung cell MRC-9, lung cancer cell
lines, H23, H69, Lu65, Lu135, PC10 and PC13 12], A549, ABC-1, EBC-1, LK-2, LU99 and RERF-LC-MA 11], Jurkat cells (a human T-cell leukemia cell line) 4], and an immortalized line of T-lymphocyte cells 14].

Recently, we purified recombinant OGG1-1b and OGG1-1a using commercial human lung
total RNA as the starting material, and showed that OGG1-1b was an active OGG1 enzyme.
We compared the enzyme kinetics of mitochondrial OGG1-1b with the nuclear OGG1-1a
protein 11], as described in the next section.

Comparison of enzyme kinetics between OGG1-1b and OGG1-1a

The reaction rate constants for 8-oxoG glycosylase activity (k_g
) and N-glycosylase/AP activity (k_gl
) were determined under single-turnover conditions ([E]??[S]) of OGG1-1a and OGG1-1b
with 100 nM enzyme and 20 nM substrate 11]. Alexa 555-labeled 36-mer oligonucleotide substrates (8OG_36_Alexa: [Alexa 555]GGAATTCCTCGAGGT[8-oxoG]GACGGTATCCGATGGCCGCT,
c-16C: AGCGGCCATCGGATACCGTCCACCTCGAGGAATTCC, c-16A: AGCGGCCATCGGATACCGTCAACCTCGAGGAATTCC, c-16G: AGCGGCCATCGGATACCGTCGACCTCGAGGAATTCC and c-16 T: AGCGGCCATCGGATACCGTCTACCTCGAGGAATTCC) were used. The k_g
of the 8-oxoG glycosylase activity of both OGG1-1b and OGG1-1a was 8-oxoG:C ??8-oxoG:T
??8-oxoG:G??8-oxoG:A (7.96, 0.805, 0.070, and 0.015 min
^?1
, respectively for OGG1-1b, and 7.21, 1.37, 0.125, and 0.031 min
^?1
, respectively for OGG1-1a). The enzymes show similar kinetic values. Both OGG1-1b
and OGG1-1a showed high specificity towards 8-oxoG:C. The k_gl
of OGG1-1b N-glycosylase/DNA lyase activity was 8-oxoG:C??8-oxoG:T???8-oxoG:G ??8-oxoG:A (0.286,
0.079, 0.040, and ~0.00 min
^?1
, respectively) and that of OGG1-1a was 8-oxoG:C??8-oxoG:T, 8-oxoG:G and 8-oxoG:A
(0.254, 0.083, 0.075, and 0.072 min
^?1
, respectively). The reaction rate constant of k_gl
of OGG1-1b and OGG1-1a was one order of magnitude lower than that of their k_g
values. OGG1-1b showed a particularly small k_gl
towards 8-oxoG:A, and an exact numerical value of k_gl
for OGG1-1b could not be calculated from the experimental conditions employed 11]. Similar multiple-turnover kinetics data (A₀
, k_obs
and k_ss
) under [S]??[E] for OGG1-1b and OGG1-1a against the 8-oxoG:C substrate were observed. Similar substrate
specificity of OGG1-1b and OGG1-1a against 8-oxoG:C and 8-oxoG:A was observed. Product
formation was higher against 8-oxoG:C than 8-oxoG:A for OGG1-1b and OGG1-1a. APEX
nuclease 1 (APEX1; NM_001641) was required to promote DNA strand breakage by OGG1-1b.
These results suggest that OGG1-1b is associated with 8-oxoG cleavage in human lung
mitochondria and that the mechanism of this repair is similar to that of nuclear OGG1-1a.

Active site amino acids

Various amino acids in the active site of OGG1-1a have been proposed, including, Gly-42,
Asn-149, An-150, Lys-249, Cys-253, Asp-268, Gln-315, Phe-319 6], His-270, Gln-315, Asp-322 15], Arg-154, Val-317, Phe-319 10], Arg-46, Arg-131, and Arg-154 16]. Hashiguchi et al. compared glycosylase activity of OGG1-1a and OGG1-2a by site-directed
mutagenesis and suggested that Val-317 is a critical residue for glycosylase activity
10]. OGG1-1b protein is identical to OGG1-1a protein from amino acid 1 to 317, including
Val-317, and is an active OGG1 11] despite not possessing Phe-319 and Asp-322. OGG1-2a protein is identical to OGG1-1a
protein from amino acid 1 to 316 but does not possess Val-317, Phe-319, or Asp-322
and its enzyme activity is low 9] or not detectable 10]. These results suggest that Val-317 is a critical residue for glycosylase activity.
Other OGG1 isoforms have not been purified and their enzyme activities have not been
determined.

OGG1-2a

Human OGG1-2 (now OGG1-2a) was cloned as an alternatively spliced isoform of OGG1 in 1997 by Abratani et al. 3] and Roldán-Arjona et al. 9]. Localization of OGG1-2a protein in mitochondria was demonstrated in COS-7 cells
4] and HeLa MR cells 3]. In addition, the expression of OGG1-2a was demonstrated by northern blot analysis and by RT-PCR in various tissues 3].

Inconsistent findings regarding OGG1-2a protein have been published. Hashiguchi et
al. 10] purified recombinant OGG1-2a (?-OGG1) and reported that OGG1-2a did not show any
significant OGG1 activity in vitro. They examined OGG1 activity with 100 nM OGG1-2a and 10 nM oligonucleotide as the
substrate, and found no activity. In the control experiment, they examined 1 nM OGG1-1a
and 10 nM oligonucleotide substrate and found active OGG1 activity. Roldán-Arjona
et al. 9] reported the purification of recombinant OGG1-2a and showed OGG1 activity against
8-oxoG:C oligonucleotide with 1 ?M enzyme and 5 nM substrate. The OGG1 activity of
OGG1-2a in this experiment was very low, because they used an unusually high enzyme
concentration.

Recently, Su et al. suggested that OGG1-2a (written as ?-OGG1) was an accessory factor
in mitochondrial Complex I function and was related to mitochondrial base excision
repair 17].

Other mitochondrial isoforms

OGG1-1c was cloned as an alternative splicing isoform of OGG1 in 1997 by Abratani et al. 3]. Expression of OGG1-1c was demonstrated by RT-PCR in some human tissues including the colon 3]. Localization was demonstrated by expressing epitope-tagged OGG1-1c in COS-7 cells
5]. The expression of OGG1-2b, ?2c, ?2d, and ?2e was demonstrated by RT-PCR in a small number of human tissues
including the cerebrum and kidney, and in the Jurkat cell line by Nishioka et al.
4]. These proteins have not been purified.

Analysis of information on the eight alternatively spliced isoforms of OGG1 archived with the NCBI

Table 1 summarizes the mRNA accession number, nucleotide (nt) length, position of the 5?-UTR,
coding DNA sequence (CDS) and 3?-UTR, exons, position of exon 1, 2, 3, 4, 5, 6, 7,
and 8 of the eight alternative splicing isoforms of OGG1, as derived from the gene and nucleotide database of the NCBI (http://www.ncbi.nlm.nih.gov/gene/4968). Table 2 summarizes alternative splicing isoforms of OGG1 CDS, nt length, identity to OGG1-1a CDS and identity to OGG1-2a CDS according to
the NCBI and examined by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Table 3 summarizes the protein accession number, amino acid length, identity to the OGG1-1a
protein, identity to the OGG1-2a protein (as determined by BLAST), position of mitochondrial
and nuclear localization signals, and OGG1 activity.

Table 1. Alternative splicing isoforms of OGG1mRNA according to NCBI

Table 2. Alternative splicing isoforms of OGG1 CDS to NCBI

Table 3. Protein products of OGG1 isoforms according to NCBI

The OGG1-1a mRNA has exons 1–7 and no exon 8. The CDS begins at nt 344 in exon 1, and the
nt sequence of 1292–1381 (90 bp) in exon7 is the last part of the CDS. The OGG1-1a CDS is composed of part of exon 1, all of exons 2, 3, 4, 5, 6 and part of exon
7.

Exon 6 is the last exon of OGG1-1b mRNA. The nt sequence 1242–1318 (77 bp) in exon 6 is the last part of the CDS.
Although the nt sequence of 1536–1882 (347 bp) in exon 6 of the OGG1-1b mRNA is the same as the entire exon 7 of the OGG1-1a mRNA (nt sequence 1292–1638, 347 bp), the former represents part of the 3?-UTR.
As for the OGG1-1b CDS, the nt sequence of 1242–1291 from exon 6 of the OGG1-1b mRNA is identical to the whole exon 6 CDS of the OGG1-1a mRNA. The OGG1-1b mRNA nt sequence of 1292–1294 is identical to the first part of the exon 7 CDS
of the OGG1-1a mRNA. The OGG1-1b mRNA 1295–1318 sequence (24 bp), which encodes seven amino acids and the stop
codon, differs from the 1295–1318 sequence (CDS) from exon 7 of the OGG1-1a mRNA, resulting in a different amino acid sequence for the last seven amino acids
of OGG1-1b when compared with the OGG1-1a sequence.

The OGG1-1c mRNA has exon 7, but the nt sequence of this exon is different from that of OGG1-1a mRNA. It also has no exon 8. The nt sequence 1292–1576 (285 bp) from exon 7 of
the OGG1-1c mRNA is the last part of the CDS, but differs from the 1292–1381 CDS (90 bp) from
exon 7 of the OGG1-1a mRNA. The nt sequence of 1309–1398 (90 bp) of the OGG1-1c mRNA, a part of the CDS from exon 7, is identical to 1292–1381 (90 bp) of the
OGG1-1a mRNA, the entire exon 7 nt sequence.

Only type 2 OGG1 mRNAs have exon 8. All type 2 OGG1 mRNAs have the same exon 8 nt sequence (861 bp). The OGG1-2a mRNA has no exon 7. The nt sequence 1292–1618 (327 bp) in exon 8 of the OGG1-2a mRNA is the last part of the CDS and the sequence 1619–2158 (540 bp) is the 3?
UTR.

The OGG1-2b mRNA has no exons 5–7. The nt sequence 1091–1417 (327 bp) in exon 8 of the OGG1-2b mRNA is the last part of the CDS and is identical to the OGG1-2a CDS, resulting in an identical amino acid sequence for the last 108 amino acids
of OGG1-2a and OGG1-2b.

The OGG1-2c mRNA has no exons 4–7. The nucleotide sequence 909–931 (23 bp: the first two nucleotides
cross a splice junction from exon 3, plus six amino acids and the stop codon) from
exon 8 of the OGG1-2c mRNA is the last part of the CDS, resulting in a different amino acid sequence
from that of OGG1-2a and OGG1-2b. The nt sequence 932–1775 (844 bp) is the 3?-UTR
and has a different length to the 3?-UTRs from the OGG1-2a (540 bp) and OGG1-2b mRNAs (540 bp).

The OGG1-2d mRNA has exons 7–8. The whole nt sequence of exon 7, 1292–1391 (100 bp), in the
OGG1-2d mRNA is a CDS. The nucleotide sequence of 1392–1414 (23 bp: the first two nucleotides
cross a splice junction from exon 7, plus six amino acids and the stop codon) from
exon 8 of the OGG1-2d mRNA is the last part of the CDS, and gives rise to the same six amino acid sequence
as that of the OGG1-2c protein. The nt sequence of 1415–2258 (844 bp) is the 3?-UTR.

The OGG1-2e mRNA has exons 7 and 8. The nucleotide sequence 1292–1312 (21 bp for six amino
acids and the stop codon) from the first part of exon 7 of the OGG1-2e mRNA is the last part of the OGG1-2e CDS, resulting in an amino acid sequence that differs from the exon 7 CDS of OGG1-1a, OGG1-1c, and OGG1-2d. The nt sequence 1313–1344 is a part of the 3?-UTR. Exon 8 (861 bp) of the OGG1-2e mRNA is a continuous 3?-UTR. The whole exon 7 nt sequence 1292–1344 (53 bp) of
the OGG1-2e mRNA is identical to part of the nt sequence 1339–1391 (53 bp) in exon 7 of the
OGG1-2d mRNA.